Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1405
Length(NT) : 877
Best Gene Model Blast : Link to GSTUMT00004467001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_13214
Accession: ref|XP_001585698.1| Score: 353 E_value: 1e-31
KEGG Definition: hypothetical protein
Accession: ang:An17g02180 Score: 328 E_value: 4e-29
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0858 Score: 327 E_value: 3e-31
PFAM Definition: DER1, Der1-like family. The endoplasmic reticulum (ER) of the yeast Saccharomyces cerevisiae contains of proteolytic system able to selectively degrade misfolded lumenal secretory proteins. For examination of the components involved in this degradation process, mutants were isolated. They could be divided into four complementation groups. The mutations led to stabilisation of two different substrates for this process. The mutant classes were called 'der' for 'degradation in the ER'. DER1 was cloned by complementation of the der1-2 mutation. The DER1 gene codes for a novel, hydrophobic protein, that is localised to the ER. Deletion of DER1 abolished degradation of the substrate proteins. The function of the Der1 protein seems to be specifically required for the degradation process associated with the ER. Interestingly this family seems distantly related to the Rhomboid family of membrane peptidases. Suggesting that this family may also mediate degradation of misfolded proteins (Bateman A pers. obs.)..
Pfam Number: pfam04511 Score: 291 E_value: 5e-27
Swissprot: Q21997|DERL2_CAEEL
Gene Ontology:
GO:0030176 = Cellular component: integral to endoplasmic reticulum membrane
GO:0005515 = Molecular function: protein binding
GO:0030433 = Biological process: ER-associated protein catabolic process
GO:0030307 = Biological process: positive regulation of cell growth
GO:0008284 = Biological process: positive regulation of cell proliferation
GO:0030970 = Biological process: retrograde protein transport, ER to cytosol
GO:0030968 = Biological process: unfolded protein response

Sequence:
>Contig1405
CCTAACATGGTATGCGCCTATGGTGTTTAATACTACACGGCCTGAAATAT
GGAGGATCGTGACCTCGTTTATGATAACGAGACCTGGCATGTCGATTATC
CTGACACCTTTCTTCCTGTATAAATACTGTAGCGACTGTGAGACAACAAA
GTTCCTCAGATCCGGAGACTTATTAGTATTTGTGCTCTTCTGTGGATTTG
TGATTCTACTCCTAAACACCTTCATCCTACAAGGCATGCTCCTCTGCCCT
GCCATGACTGCCGCCCTGGCATACTACTGGACCGCTCTCGAGAACAAAAA
CAACTCGGTCAACTTCTTCATCGTCCGCTTTCCGGTAAAGTACCTCCCTT
GGGTCATGATTTTTGTCACTCTAGTGGCAGAAGATGTCGGCTCAGCCCTC
GTCGAAGGAACCGGCATCATAGCAGCTCACCTCTACCTCTTCCTCACAAA
CATCTGGCCCCGTGTCGCCGGCGGTCGACACGTAATTTACACTCCGCAGT
GGGTTCACGGATTATTTGAGGAGCGCGGTGATCCGGCTACTAGGGGTATT
CGCGCTGGCGTCCCGCCTTCCGTGGCTGCGGCAGGGCCTGCTGGAGGTGC
GAGCGCTACTGGGAGGAGCATGTTCGCGCCGCCGGGGACTTGGACCCATA
GGGGGCAGGGGCATCGGTTGGGGAGCTAGGCGGTTTCCTGAATTGGGGTT
GGCGTGGTGCGATGGGATAAATTAAGTAGATAATATTAGGATAGGTGTTA
TGGGGATCGTTAGAAAATGTAGCTGACTTTCCCTCTTGATTTTGTTTCAC
ATTTTTCTATATACCTCGCTGTATGTTGGTATGTCGGCATGCCGAGGTGG
AAATGGGTCCTTTGTATTGCATTTTTA

Sequences in the Contig:

SY0AAA15YJ14FM1 SY0AAA49YP12FM1 SY0AAB4YK14FM1
SY0AAC10YD20FM1 SY0AAD36YG16FM1 SY0AAD52YG03FM1