Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1404
Length(NT) : 775
Best Gene Model Blast : Link to GSTUMT00001408001 E-value : 1e-159
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_02732
Accession: ref|XP_001229248.1| Score: 373 E_value: 4e-34
KEGG Definition: hypothetical protein ( Chain A, Crystal Structures Of A Pentameric Fungal And An Icosahedral Plant Lumazine Synthase Reveals The Structural Basis For Differences In Assembly )
Accession: ncr:NCU09371.1 Score: 358 E_value: 1e-32
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG3243 Score: 310 E_value: 2e-29
PFAM Definition: DMRL_synthase, 6,7-dimethyl-8-ribityllumazine synthase. This family includes the beta chain of 6,7-dimethyl-8- ribityllumazine synthase EC:2.5.1.9, an enzyme involved in riboflavin biosynthesis. The family also includes a subfamily of distant archaebacterial proteins that may also have the same function..
Pfam Number: pfam00885 Score: 260 E_value: 1e-23
Swissprot: Q9UVT8|RIB4_MAGGR

Sequence:
>Contig1404
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGTTTTCAGGAACTAAAGGA
CCCGGCGAAGCGGAGGCTCTAGATGGCACCAACCTCCGCGTCCTCATAGT
TCATGCCCGTTGGAATACCAGCCTCATCACACCACTCGTTGAAGGAGCAC
GTAAAAGGCTCCAAGAGCGTGGTGTGAAGCCTTCCAACATCATCACCCAG
AGCGTCCCGGGCAGCTGGGAGCTTCCTATCGCTGTTCAACGGTTCATACC
ACTCCTCCTTGTTCACAACCACCATCTATCTGCCGCCCCCCCACATCTAA
CATAAGAATTGAATGAAAAAAATAGTTTGTACTCTGCCAGCCAAGTCCAA
GCCTCGTCCGCCCCCTCGGGAGACCTCCTCGGTGGACTCGGCCGTAGCTC
AACTCCAGTTCCTGGGAGCGAGTTCTAGCAGTAAGGGGACATTTGACGCA
ATAATTGCCATCGGCGTGCTCATCAAAGGTGATACCGCGCATTTCGAACA
CATCGCGGAGACTGTCTCTCGTGGACTCATGAGGGTTCAGCTGGACTTTG
GTGTTCCGGTTATTTTCGGTTTGCTCACTGTCTTAAACGAAGAGCAGGCA
AGGAAACGCGCTGGATTGACTTCCGATGGGCATAACCACGGTGAAGACTG
GGGAGACGCAGCTGTCGAGATGGGAGCCAAGAGGAAGCTTTGGGCCGATG
GCGTTATTGGATAGGCTTGAGTTATAAATATAAAATAAATTAAAGTCACT
GGAGCCGGGTTTATTGATTAATGGG

Sequences in the Contig:

SY0AAA49YP03FM1 SY0AAD46YN23FM1