Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1403
Length(NT) : 938
Best Gene Model Blast : Link to GSTUMT00012038001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: Sit4-associated protein (Sap185), putative
Accession: ref|XP_001271967.1| Score: 807 E_value: 3e-84
KEGG Definition: Sit4-associated protein (Sap185), putative
Accession: afm:AFUA_4G11012 Score: 793 E_value: 6e-83
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG2073 Score: 482 E_value: 3e-49
PFAM Definition: SAPS, SIT4 phosphatase-associated protein. This family includes a conserved region from a group of yeast proteins that associate with the SIT4 phosphatase. This association is required for SIT4's role in G1 cyclin transcription and for bud formation. This family also includes homologous regions from other eukaryotes..
Pfam Number: pfam04499 Score: 277 E_value: 2e-25
Swissprot: O74511|EKC1_SCHPO
Gene Ontology:
GO:0005721 = Cellular component: centric heterochromatin
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0007059 = Biological process: chromosome segregation

Sequence:
>Contig1403
ATCTTCTACCGTATTCTCAAACCTCATCTTAGAATTTTCTCTTCATACCG
CACATCGTCGTCACCTCGTCACCCTACAGGGGTGAGATTAAGTTCTCCCG
ATAACGCCCTATCAGCCGCCAAACCTCAGCTCAGTACAGTCTACGCAAGC
TATCATGTTTTGGCGATTCGGCGGCTACGCCAATATCTCAACCCTTGACG
CGATTCTTGAGAAACCTGATGTGACGCTTGAAGATCTGCTTGAGGAATCA
GATTTAATCCAAGAGCTTAAACAACAGAATGCGAAGTTGATTGAATTTCT
CCGGAGGGAAGATGTTATGTGGAAATTACTCGAATACGTTGTTGCACCCA
AGCGTTCAGATCCAGCATCTGAAGAGGCAGGGAATAATGCTGCCGAAGCT
AGTAGTGGAAACGAATCTGAAGACGGCAATCCAAACGGATGGAATCAACT
CCCTGACACGGAGAGGGATAAGGAGGAGAAAGTTAGGCTGAAGTATGCCT
ACGTTTGCTGCGAGGTTCTATCTAGCGAGTCCTGGTCCATGGCGGAGACA
CTGGTAGAGAATCTGCAACCTCTACGTATGTTCTGGAGTTTCTTAGAGCG
TCCTGCCCCTCTCGATCCTTTACAGGCTGGCTATTTTACGAAGGTCAACG
AGACATTACTAGACCGAAAAACGGATGAAATGATGGAGTTTTTCAAAGGC
CTGGATAATATTGTTCCTAAGATATTGAAGCACGTGGATTGCCCAATGAT
CATGGATCTGTTACTGAAGATCATCAGCATGGAGAAGTGCGAAGGGGGGA
CTGGTATAGTAGATTGGCTCCATTCACAAAACCTAATACCTTTGCTACTC
TCCTTCCTTTCTTCGGACCATCCTGCGACTACTCAAACTTCGAGTGGGGA
CTTTATCAAAGCAATCATTACAATCTCTGCCAATGCTT

Sequences in the Contig:

SY0AAA49YP01FM1 SY0AAA55YM14FM1 SY0AAC43YN05FM1