Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1402
Length(NT) : 2142
Best Gene Model Blast : Link to GSTUMT00001153001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein HCAG_03945
Accession: ref|XP_001541847.1| Score: 1928 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: yli:YALI0F18084g Score: 1892 E_value: 0.0
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 760 E_value: 5e-81
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 777 E_value: 5e-83
Swissprot: P0AE24|ARAE_ECOLI
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1402
TTGGGATGTCTTGCCTTCTTGTGCACCACACACAGTCCCCAACTCCAATT
CTGTGGCGGCTATAAGGTAGCTGATATCCCCCTTCCCCCCCTAATTACCT
CTCTCTCCAGTCAAAGAGGTTGGGGAATCATGTCAAATCCAATTTCTAGC
ACATTGGGCTCTCCGGATGCGGAGAAACCTCTCTCTGTTGGCCCACATGA
GCACCAGCCAGCATCAAAGAACCAACCCGAGGATCTACAAAAGCTCAATT
CCAAGCTTGCGCACCCCCTCTCAGGGATCCCACATGAGGAGCTAATGGAA
ATGGGCGCTTCCTATGCTCGCGAGAACGGTATGGAAGACTTACAAGACGA
GTTCAGGAAAGGAGCCCTTCTCGCTCAGAAACCTGAAGCCTTCGATACAT
TACCATTATTGACGGACGATGACAAATACTACCTACGAAGAGAAGTTACC
CACAAGTGGAGTCACCCCAAGGACCTATATCATATGGTTGTAATGTGTTC
TATGGCTGCGGCAGTTCAGGGAATGGACGAAACCGTCATCAACGGGGCTA
ACCTTTTCTTTCTCAAACAATTTGGAATTGAGAACCGAGAATGGATTGCT
GGTCTCGTTAATTCGGCACCATATTTATCTTGTTTTACCGTCGGTTGTTG
GTTAACCCATCCTCTCAACAAGCAATTCGGTCGTCGGAACACTATCTTCA
TCACTTGCTTTATCTCCTTCGTGACATGCTTATGGCAAGGGTTCGCGAAC
ACATGGCCTCATTTGTTTGTTGCAAGATTTATGTTAGGTTTTGGTATTGG
CCCTAAGAGTTCGACTGTCCCGGTTTATGCGGCGGAATGCTCGCCGCCAG
CAATTCGAGGTGCTTTGGTTATGATGTGGCAGATGTGGACTGCATTTGGT
ATCATGTTGGGTTATATCGCCGATGTTGCATTTTACAATGTCAAGGACCC
ACCCCATATAACCGGTCTCAACTGGCGTCTCATGCTTGCCTCCGCTATGG
TCATACCCTTGATTGTTTGCTTTCAGGTCTATTTCTGCCCTGAGTCCCCC
CGTTACGAAATGTTAAAGGGCCGCCATAAGCGCGCTTTCGACTCGCTCGC
TCGTCTACGATGGACAAAGGTCCAAGCCGCTAGAGATTTGTTCTACATGC
ACACTCTTCTGAGGGTCGAAGCCGAGTTGAACAAGAAGAGTGGTTACAAG
CTCGTCGAGTTCTTCACTATTGGGCGTAACAGGAGAGCTATGATTGGTTC
CGAAATCGTTATGTTTATGCAGCAGTTTTGTGGAGTCAACGTTATCGCAT
ACTACTCTTCGGTCATCTTTAAGGAATCTGGGTTTACTGTCATCGATTCC
CTATTGGCCAGTCTGGGCTTCGGAATCATTAACTTCCTGTTCGCTATTCC
TGCGGTGTATACCATTGATACCTTCGGTCGCCGATTCCTACTTCTTGTTA
CGTTCCCACTTATGGGCCTCTTCCTGCTATTCACTGGATCTTCGTTCTGG
ATTCCCGATAGAGAGGCAAGGATTGGATGTGTTGCCCTTGGAATTTATTT
GTTCGGGATAGTGTACTCCCCTGGTGAAGGGCCGGTGCCATTCACATACT
CAGCAGAAGCGTACCCTCTCTACATCCGTGATCTCGGTATGTCACTCGCT
ACAGCGACGACATGGGGTTTCAATTGGCTGCTGTCGATGACCTGGCTACC
GCTTGTACGAGCATTCAAACCACAAGGAGCCTTTGGATATTACGCAGCAT
GGAATGGTATTGGGTTTGTTCTGGTTCTGCTCTTCCTGCCCGAGACCAAG
GGAAGGACTTTGGAAGAGTTAGACAGAGTGTTCGAGGTTCCTACAAGGAG
TCACATGAAGTATGGGTTGGCACAGGTTCCATGGTTTTTCAGGCGATACA
TCTTCCGACAAGATGTCCCAGCCCCCAAGATATTGGAATTAGAAGAATTA
GAAGATATAGAGTACCACCCAGACGCCTTCCGGAACGGGAGCAAAGATAT
AGGTGAGGGGAACAGCGTTTAGGTAGGAACAGAGTTGTTTATGGGTTTTA
TTTATTCCCTTTGTTTTCAAGATTACCAGTTGGGGAACCCTTTCGAGTTA
GTCTATTAGACTAGACGTGCTCTAAGAACTTTTTTTTATCCT

Sequences in the Contig:

SY0AAA13YM15FM1 SY0AAA18YJ20FM1 SY0AAA26YI23FM1
SY0AAA36YB03FM1 SY0AAA37YG14FM1 SY0AAA38YK24FM1
SY0AAA49YO11FM1 SY0AAA61YI11FM1 SY0AAB24YE04FM1
SY0AAB2YE14FM1 SY0AAB33YI07FM1 SY0AAB42YH06FM1
SY0AAB47YI08FM1 SY0AAB53YN10FM1 SY0AAB55YH15FM1
SY0AAB61YC18FM1