Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1401
Length(NT) : 1519
Best Gene Model Blast : Link to GSTUMT00011429001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001208914.1| Score: 260 E_value: 2e-20
KEGG Definition: hypothetical protein
Accession: ang:An16g02960 Score: 255 E_value: 3e-20
KOG Definition:
Classification: [Extracellular structures].
Kog Number: KOG3544 Score: 186 E_value: 1e-14
PFAM Definition: Cytadhesin_P30, Cytadhesin P30/P32. This family consists of several Mycoplasma species specific Cytadhesin P32 and P30 proteins. P30 has been found to be membrane associated and localised on the tip organelle. It is thought that it is important in cytadherence and virulence..
Pfam Number: pfam07271 Score: 115 E_value: 2e-06

Sequence:
>Contig1401
TTGGCTCAGCGATCTCTACACAAGTGCCGTCAAGGCCTTCTCAAAGACAT
ACACCGAAGGCCCCATCATCGCCACGGATTTCAACCCCATCCAGGACCTC
ATCCAGCGGCTCAACCTGGAAATGGAAACGACAACCCCAGCGTCGGTATA
CTTGCACCAGAAGCATGTATCGGAATCCTTCTCCCGCGACCTCGTGAATG
CCTGGTCTCGCGCCGCCACGGGACAGAACCTGGGCAGTGTGAACGCATTC
ACCGCGCTGCGGAGCTCATACACGGGCACCATCGAAACGCCTGTCGGCGA
AGGGACCGGAGCGCTCTTCAATTGCCTACTAGGAGCCTCCAGGGCGGAAC
ACATCCCTCAGGAAGTTACCCGTGTGCGTAGGAACGCGCTAAGCCTGGAA
GGGGAGTGGAAAATTACTTCCACCCCGCAAATCCCCCTCAAGTCCGAGGC
CGAGGTCGAGGACGATGTGAAGTTGGGCACTGGCTTTGACCACGTAATCC
TCGCTGCACCATTCTATTTTTCGCATGTACACTTCGATGAGGAGCAGCTC
GACGCTGTCCCGCACGTAATGAATTACACGACGCTGCACGCCACATTCTT
TACCATCAACTCGAAGGAAAAGGTAGGTGGCTCTTGTGACAACATTTTGA
CAACACTCCAGCCAGGACACTTTGAAAGGGGCCAGCTCAGGCCCAGCCCC
GAGGACGGCGGAAGTGCAGGCGTCTACTCTATACGCTTATGGCGTATGAT
AGAGTTAGATGGTGCATTAGTAGACGTGTACAAAGCCCTCTCGCCAGCAC
AAATAGACAAGGACGGCATAATGCACGTGTTGAACGCCGTGGGCTGTAAA
CACCCTGTTGAAATCCTGGCGCAAGTCGAGATCAAAAATGCCTACCCAAT
CCACCACCCCCGGACCGCATTCTCCCACATCAAGCTCAGTAAAGGCCTCT
GGTACACAGGTGGTGGTGAGGAAGTAGGTAGTACCTTGGAATTAAGCGTG
CTAATGGGAAAGATGGTGGCTGGAGGGCTTGTGCGGGGGCTCAAGAACCA
TGAACTCCCACCCAAAGCGCGACAAGAGGAGGGAGTAGAAGAGCTGGTAA
TGGAGGGGGACTGGGATAGGGACGACGACGATGAAGGGAAACGTCCCGGA
AGGCCAGAGAGACCAGAGAGACCGGGGAGACCGGAGAGACCAGGGAGACC
AGGGAGGCCGGGGAGACCAGAACGCCCGCAGAGGCCGGAGAGACCCGAAT
TCCTGTCCGGTGATGACTTGTTGGAGCGCCCTGAAAACCCAAAGACATTG
GGGGGCGGGGTAGGGGAGGTGGAGGAGGGGGGTGGCGGAGACGGTGCTCC
TCCCAAGAAACCGGGACACCCTGATTGGCCCGAAAGACCCGGGCGGCCGG
AACGTCCTGGGCGCCCCGAGAGGCCGGAGAGGCCGGGCAGACCTGGGGAT
GATCCAAAGCGTCTCAGTGACGGGGGAAGAGCGAGGAGGTTTTGAGAATG
ATATTATGATTTGTTTGTT

Sequences in the Contig:

SY0AAA49YO01FM1 SY0AAA8YK02FM1 SY0AAB9YJ16FM1
SY0AAD27YI09FM1