Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1400
Length(NT) : 660
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN3864.2
Accession: ref|XP_661468.1| Score: 231 E_value: 9e-18
KEGG Definition: hypothetical protein
Accession: ani:AN3864.2 Score: 231 E_value: 5e-18
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4353 Score: 209 E_value: 9e-18
PFAM Definition: NTF2, Nuclear transport factor 2 (NTF2) domain. This family includes the NTF2-like Delta-5-3-ketosteroid isomerase proteins..
Pfam Number: pfam02136 Score: 140 E_value: 8e-10
Swissprot: Q9NPJ8|NXT2_HUMAN

Sequence:
>Contig1400
TTGGGCCACTACCGATAAGATGGAATGATGACTCAGCCCATGATACGAGT
ACTCGAGTACATAAGCTAAGGTTGCCTGAATAAACTTTACCCCTTCGACA
TCACCAACCTCCTCCTCCGCTGCCTCAAAGAAGCACAAACAGCCACAAAC
AAGCGTCAAATCTTCTTCTGGCTTTTCAATACTTAGCCACATTCAATCAT
CACAATGAATAGCAAAGCCAGTAAGGAGCCCTCGATTAAAGCTGCAGCAG
ATGATGCGACAAAGTTTATTGGCTCATACTACGAAGCCATAAACACGAAC
ACAAAGCGAGCATCGCTCGAAAATTTCTACCATCCCAGCGCTTCCATTGT
GTGGAACGGGAACCCCATAACCGGTGGGGAGGCATTTGCGCGGTTCTATG
AACACATGCCAGTAACTCATTATGATGTCAAGTCTTATGACTCTCAACCA
ATGCTGGTGCCCGGCACCTCAGGCGGGCCCTGCAACTATATGGTTATCGT
CTCTGGGAGTGTCAAGTATGGAGATAGCAAGGAGCAGAGGGGTTTCAGCG
AGACTTTTGTTCTAAAGCCAAGCACTACAGATCCGAATCGATATATAGTA
GCTACTCAAGGGTTTAGATTGGTGGTTTGAATGGGCGGATGCAGGGCGGC
GGAAGATGTC

Sequences in the Contig:

SY0AAA49YN23FM1 SY0AAD10YA03FM1 SY0AAD42YO20FM1