Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig140
Length(NT) : 390
Best Gene Model Blast : Link to GSTUMT00000639001 E-value : 1e-122
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig140
TTGGCTCTACCTCTCGCCTCAAAATCTAAATTTACCCAACCACCACACTC
TTTTCCATCACCTCACTCACTGAGCTTTGCTTCTCTACCCCCCCCCCTCC
CCACCTCCGCCCTTCACTTATACACCTTCCATCAGTTCCACAAATAGCGG
AACAAAGAGGTATACACCACTATGTTCCGTCCGTTGCCATTATGGAAGAG
CATACCTTGCCCAGCAATAAAATCTGGATCAGCCTGTTCCCTACCGCATT
GCTTGTTTTCTCATTCAATGGTACCTGCCCCTGCCATCATCTCAAGTCTC
TCATCTCCGGCACTCCCGAGCACTCAGTCGCCAGCCAAGAAGGAAGCTTC
ACCGAGTTCTTCACCACGCCCTCCCACAGTACCAACTCCC

Sequences in the Contig:

SY0AAA15YC10FM1 SY0AAB46YI01FM1