Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig14
Length(NT) : 664
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: ankyrin repeat domain protein
Accession: ref|XP_001273619.1| Score: 254 E_value: 2e-20
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 237 E_value: 9e-19
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 195 E_value: 4e-16
PFAM Definition: No Hit Found
Swissprot: Q1RJR6|Y317_RICBR

Sequence:
>Contig14
TTGGATATCCATCTGTCTTGGGAGTCTCGACATTAGAGGTGATCTGAATT
ACAACGAGGTTAACGATTTTTCGGCCTGCGCCTCTTCTGATCTGCAAGAC
ACACACCCTCCTGAATACCTTTCGCTTTATTTCGGAATCCAGGTAAAAGA
GGACCTTTCCGATTGCACGGGATTGTTTGGGCGGAATTTATTCTACGACT
ACGATAACTCCATATCTACCAAATTCTTCCTGAAACCGCAGGAATAATAG
CGGTACTACTGCTCGCACACAATTTATTGCGATAAGCCTTCCCGATCCAG
AGGTCTATACTCTTCATCCCGTTGCAGGGTTGTAACTGGCCAGGCAGAGA
TGGAAGGTTATTTTGTGAACCACCGTGACCGCGCAGGCAAGGCGCCCCTC
GTGTGGGCTGCGCAGAATGGGCACGAAGAAGTGGTGAAAATGCTACTGGG
ACGGGACGACGTCAATCCTAGCAAACCAGATAAGTCTGGTGGAACGGCGC
TCTGGTATGCTGTTCAGAATGGGCATGAAGGAGTGGTGAAAAAACTGCTT
GAACGGGAGGACGTTAACCCCAATGCACCAGGAGAGGGCGGCGAAACGCC
ACTGCATCTTGCTGTTCGGAATGGGCGTGAGCGAGTGGTGGGGGTGTTGC
TCGGACGGGGCGAC

Sequences in the Contig:

SY0AAA10YG11FM1 SY0AAA48YN07FM1