Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1399
Length(NT) : 1094
Best Gene Model Blast : Link to GSTUMT00003049001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: methylenetetrahydrofolate reductase (predicted)
Accession: ref|NP_595877.1| Score: 935 E_value: 5e-99
KEGG Definition: hypothetical protein [EC:1.5.1.15]; K00295 methylenetetrahydrofolate dehydrogenase (NAD+)
Accession: spo:SPBC1711.04 Score: 935 E_value: 3e-99
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG0089 Score: 615 E_value: 1e-64
PFAM Definition: THF_DHG_CYH, Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain..
Pfam Number: pfam00763 Score: 214 E_value: 5e-18
Swissprot: Q9P786|MTD1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1399
TTGGCCATGATATCACAACATGATTCTCTCATTCCCCTCACACCTACGTA
TTATTGTGGTGTAGCAATGCCCACCCGGAGCCTTACTTGCACCCTTCTCG
AGTGCCTTACCGCCAAGCCATCCGCAGCCTTACCACCTTCACTATCAATA
GCCTTACTAAAAATTTGTCAACGTAGGAGTGTCTCCTCCATCTTCAACCT
TTCACTCCTCTGTTCCTTGGCCCGCTACTCACCCGAACAACAGGGCTCTT
TTAAAGAGGCAGCACACAATGTCCACAATAGTAGAGGACCCTGCGCCCCC
TACTTGCAAAGTCGTCTACGCCTCCGCCGTGGCCGAGGGCATACTGGGAG
AAGTCAAGGACTCAATCGAGAGGCTGGGGCGGGCGCCATTGTTGGTTGGG
TTTCTGGCGAATGTAGATCCCGCGGCGAGGATGTATGCTAGCTGGACGGG
GAAGACTTGTTTGCAGAATGGGGTAAGGTTTGAGCTTAGGGAGGTGGGTA
AGGATGATCTTGAGGAGAACATTATCGCGGCGAATGCGGATGATGAGGTT
GGGGGGATTATTGTTTATTATCCGGTTTTTGGGAGTAGTCAGGATGCATA
CCTCCAACAGATCACCTCCAAAGAGAAAGATGTTGAGGGCCTCTCGCACG
CTTACTTGTTCAACATGTACCAGAACATCCGCTTCCTCGACCCAGAAAAG
TCGCAAAAGTCGATCCTGCCATGCACACCCCTAGCTATCATCAAGGTCCT
TGAGCACATCTCCGTGTACAACTCCATCCTGCCTTATGGTAACAGGCTCT
TTGGGAAGACTGTCACTGTCGTCAACCGCTCGGAGATTGTCGGACGTCCC
CTTGCAGCTCTGTTGGCCAATGACGGGGCAAGCGTGTACTCTGTTGACAT
TAACAACGTGCAGTACTTTACCCGGGGCGCGGGGATCAGGAGACGGCAGC
ATGAGGCTCATGACACGGACTTGAAGCTCGAGGATGTGGTGCCCAAGAGT
GATGTTGTGATTACTGGGGTGCCGAGTAAGGAGTATAAGTTTCCTGTGGA
GCTGCTGAAAGACGGTGCGGTTTGCGTGAACTTTTCTTCGGAGA

Sequences in the Contig:

SY0AAA14YK13FM1 SY0AAA16YO05FM1 SY0AAA23YM11FM1
SY0AAA47YP02FM1 SY0AAA49YN19FM1 SY0AAB1YB19FM1
SY0AAB23YC03FM1 SY0AAB23YL01FM1 SY0AAB28YM22FM1
SY0AAB3YP19FM1 SY0AAB40YE13FM1 SY0AAB52YF04FM1
SY0AAC43YD09FM1