Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1398
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00003292001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_14446
Accession: ref|XP_001584677.1| Score: 263 E_value: 2e-21
KEGG Definition: hypothetical protein
Accession: ang:An08g01380 Score: 235 E_value: 2e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1398
TTGGGGGCCGTCGATGATGAAGACCTGCTTGCCCTTGGCAACCTGGACGA
GCGTCACCATGTCCAAAATAACGGACAGTTTGGAATAGACCACCACCAGG
AGCAAAGGCATGGGCATGGCGATGACTACTCCTCCCTGCAGCATTTCTTT
CCCGACATGGATGGGGGTGGGGATAGAAGCGCAACCGGGGAAAACGGTGC
ATCGACTGGTGCCACAAATGTTGACCCGGCATATTCTCACACACCTGATA
ACAACCCTTCGACTGAATCCCCCTTTATTCATTCATTCCCCCCTCAACAG
TTCCGGCAATTGCAGCATCCTTACAACGGAGCAACTGCTGATACACCCTC
TTCATACAACGCCTCTCCGGTTATCGGGTCAGATTCAACACAAGGGACCA
ACTTTGACCAGTATATGGCCCCTGGAAAGCGAAAGAGTCGGCCAGTTTTG
GAAGGAAACGGCTCCCGTAAAAGCCCCAACTCGCGATCTCCACATACCCC
CAAGACCCCGGGTATTGGCTCTCTCTCGCTTGGCGGTGAATCCTCGAGCG
TCCCTGCCCAACCCATCCAGACCTCCCATATGGCTTCCCACCGCCATCAC
AAATCCCTCTCGAACCAGTGGGACGGGACACCGGGCTCGCAAATCTCTTA
TATTGACTCGCCCCTCTCCTCTCCAGGAGCCTCCCATGTTCATCCTCA

Sequences in the Contig:

SY0AAA49YN18FM1 SY0AAC34YA23FM1