Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1397
Length(NT) : 1110
Best Gene Model Blast : Link to GSTUMT00010612001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: MFS sugar transporter, putative
Accession: ref|XP_001261530.1| Score: 765 E_value: 3e-79
KEGG Definition: MFS sugar transporter, putative
Accession: afm:AFUA_7G05830 Score: 751 E_value: 6e-78
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 410 E_value: 9e-41
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 444 E_value: 1e-44
Swissprot: Q96290|MSSP1_ARATH

Sequence:
>Contig1397
TTGGGAAACTATGAATCAGCCTTTAGATCATTAATTCGTCTCCGCCACTC
GAAAATCCAAGCTGCACGGGACCTGATATACATCGACGTCCTCCTGGAAG
CTGAGAAGCGGATCTCGAACCGCCGCAACCGCCTGGTAGAAGTCTTCACA
GTCCCGCGAAACCGCCATGCACTACAGGCATCGCTCACGGTCATGATTAT
GCAACAATTCTGCGGAGTCAATGTGCTCGCATACTATTCTTCCGAGGTCC
TCAAGGGCTCCAAAACCGACTACAACAGCATCCGCTACGCACTCTTAGGC
AGCATGGGCTTCGGCATCATCAACTTCCTATTTGCAATTCCGGCCGTGCG
CACAATAGACACCTTTGGCCGGCGAAACTTACTCTTATTTACATTTCCGC
TGATGGCGATATGCATGCTGATAACATTCTTCCTGGAAGACATACACAAC
AAGAAAGATGGGGCACCACTAAGTCTCATCGGAATGTACCTCTTCGCCGC
GGTGTATTCTCCGGGCGAAGGCCCTGTCCCATTCGTCTACTCAGCAGAGT
GCTACCCGCTGTACATCCGCGACATAGGCATGGCAATCGCCACCGCCGTG
ACCTGGTTTTTCAACTGGCTGCTGACGATCACGTGGCCGCCTCTCCACGA
TGCGATACACTCAGCCGCCTTCGGGGTTTATGCTGCACTGAATGTTATTG
GATTCGTGGTCATTCTGTTGCTCGTCCCTGAAACTAGGAATCGTACGCTG
GAGGAGTTGAATAGCGTTTTCGAAGTGCCGACCAGGGATCAGGCAATGTA
TGGCATTCGTCAACTCTGGTGGTTCTTTGGAAGTTGGATCTGGGGCAAGG
GGGAGCAGGTTGAGAAGCCGGTTCTGGTTGTCGGGAATAGGAGTCGGGAA
GATGTAGCGTTTCCGCCTAGAGAGGGCGAATTTGGGATCAGAGCCTTCCC
ACCGGGTCGCGATTCTTCGTCGGTTCACGGAGCGACATGAATTTGCATTT
TCTTTTTATCAAACTAAGGAGTCTAATTACTTCCGGGCGTCATGAAATTT
TGGGCTCGGGGGGAATCAGTTGGAGTTTTGGATTATAATCGTTTTTCTCT
TTTCACAAAA

Sequences in the Contig:

SY0AAA35YE21FM1 SY0AAA49YM17FM1 SY0AAB3YC10FM1