Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1396
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00010265001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_02101
Accession: ref|XP_001248330.1| Score: 744 E_value: 3e-77
KEGG Definition: mitochondrial tricarboxylate transporter (Ctp), putative
Accession: afm:AFUA_3G05420 Score: 732 E_value: 3e-76
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0756 Score: 442 E_value: 9e-45
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 188 E_value: 2e-15
Swissprot: O13844|YFG5_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1396
TTGGACCAACTATAATTTCCAGCTCACCAGGTTCACGGGATGTCTAATAC
TGCCACAGACAGAGCAAAAGAGAAGCCGAGCGTTACTCGTTCACTTATCG
CAGGAGCAAGTGCGGGGGCGATCGAAATTGCGATTACCTATCCGGCGGAT
TTTGCGAAAACGAGAACGCAGTTAAATCGTCGACTAGCCACTGCGGAGAA
GCTTCCATGGCCCAAATTTGGAAAGGAATGGTATGCGGGGTGCACTACGG
CCATAATTGGCAACTCTATTAAGGCGGGCATTCGTTTTCTTGCATTCGAC
GCTTTCGTTAGTCTCTTCGCGGACGAGAACGGAAAGATTAGTGGACCAAG
AACTGTCCTTGCAGGGCTTGGAGCTGGTACTACGGAGTCGTTGATCGCCG
TCACACCGTTCGAAAGTATCAAGACTCAATTAATCGACGATCGTAAATCC
GGGAAACCACGAATGCGGGGATTTATTCACGGCTCTAGAGTTATTTGGAG
GGAGAAGGGGTATCGTGGTTTCCTTCAAGGTCTGGTGCCTACCACTGCCC
GTCAAGCCGCAAATTCTGCCGTGAGATTCGGATCGTATACTACTATTAAG
CAGTTTGCGCAAAGCTACGTCGCCCCGGGTGAAAAGCTTGGC

Sequences in the Contig:

SY0AAA49YM16FM1 SY0AAC4YG04FM1