Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1395
Length(NT) : 552
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1395
CACCATCACCTACTGGTATGACAACATCCCGACATTGACGACTTCGAAAA
AGCCTAAGCGATGCTCTGCAAATCTGGGAGCTGCCCAAATCCCCCAGATC
CCGGGATGGAATCATGAGGGTTCGCGCGTGGCATCTTCCCCCGGGCCCAA
TTTGCCATTGTGAACTTACCCTCCTACGTGTAACAACAACGGACATCAAC
TCTCGAACTATCCTCAACAACCACACTCGCAACATCAACCAATCAACCAA
AATACTATTTCCCCTTCCCAAACAGAGGTACCCTCCCCTTCCTCCCCTTC
CTCCCCCCGCGGCATAAAAATCCACCCCCCCTAGTCCAAATGCCCCCACC
CTACCCCTTCCTAGGAGTAATAATGTTCCTGTCGAGTCTTCTAGCATACT
TCTTTACACTCTATTCCGGCATGAGTTCTTCTGTGGATGGTGGTGAGCGG
TGGAGGGAGGTGCGGAAGAGTAGTATTGTTGGCTTCTTCGCGCAAGATTT
GGAGGAGACGGATCCAGGGAGATTTGATTGGGTTGGCTTTCGCTCTATCC
AT

Sequences in the Contig:

SY0AAA37YP10FM1 SY0AAA49YM06FM1 SY0AAB45YA23FM1
SY0AAC14YH13FM1