Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1394
Length(NT) : 1396
Best Gene Model Blast : Link to GSTUMT00000876001 E-value : 0.0
Numbers of ESTs : 88

Blast Results:

Nr Definition: hypothetical protein SNOG_15203
Accession: ref|XP_001805361.1| Score: 336 E_value: 2e-29
KEGG Definition: hypothetical protein
Accession: yli:YALI0B07601g Score: 290 E_value: 2e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1394
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGCGGCCAGTGATTTCCAT
GGCATGATAACTGGACGCTGATGGAGATATATATGATAGATCCAACCTCC
TGCTACCCTCTCTTCCCCATTCTACTCGTAATAACCGCCAGCACTTCCAT
TCACTAAGCGGAGTACTTACTTGCGGAGGCTTAACGGAGCATCAACACAC
CACACAACGATAAGCATGCGCTTCTCAGCGATCGTCCCGATAGCTCTGTC
TATCGCGGCCTTCATACTTTCTATGCTAGTGCTGTTTGCCGGTAGGAATA
ATGGGTTCCTGGGCGACACTTATGTCACTAAGATCGATACTTCAAACCTC
AACGTTTCAAACACTGGCATCAGCGCACTCGACAATATCCTCGACTCAGC
CGCCCAGGACATCGTTAATACCACTGCCTCTCGCCTCGGTTTGCACGATT
TCTACAAGGTCTTTATTATGAACTACTGCGAAGGCGAGCGCGATTCCAAC
GACAATGAGCGGATTACAAACTGCACTAAGCAGAAGGGGATGTTCACCTT
CAATCCTGTCGGTGTTTTCGAGAGGGAGTTGTTGCAAGGCGTGACGTTGC
GGGACCTGGGTGTCAATACTCAGGACCTCGACACCGCTATCAATGTCTTG
AAAGTTGCGTACAGGACTATGTTTGTCACGTACTGCATTGGAATTACCGC
TGCCGGCATCGCTATTATTCTCGGATTCCTAGGATTTATTGAGAGTAGGC
TTATCGCATGCTCTAATTGGATGTTCGCTGTGATATCCTTCCTATTCCTC
GGTGTTGCATCGGGAATCGGAACTACCACTGGCGTCAAAATTCGTGACGC
GATAAATCGTGAGATGGGAGGAATTGGTGTTCGAGCCTACATTTCGAAAC
GGTACCTCGGTATGACATGGGCTGCCGTTATCTGCATGCTCATTGTCACA
TTCTTCTGGTGTGGAGCTTGCTTCTCCAGGAGAAAGAACCGAACCCACCA
CAAGAGTGCCGATGAAAACCAATTGGCTGGGTCCGGGCCTGTCGGGAAGA
AAAAGAGGTCCTGGAGGAGATGGGGCCATTAGAGAGGGGTAGCATGATTT
TGGGTACCGGTAGTGCGCGATGGATAATGAACGTTCCCCTCATTAATGTA
TTTGTATAAGTTTTCCGAGAGCAGGACTGTTTTGTCTTATCATGATTATT
TCTGATTATTTCCTCTCCCTTTTTCCGGACACTGCTATTGAACGAGTCTC
CTTTGTTCTCTTTTCTTCCCCTCTCCAAGATACCTTGTTACCATTCTTGC
CACCATATCATATCCTTTTTCACCTTCTTGTCGGCAGATCTCATCGCGCT
TAACCGAAATAGGCGCACTCTAGATGGTTGAGAATTTAATCGTGGT

Sequences in the Contig:

SY0AAA10YG07FM1 SY0AAA10YM06FM1 SY0AAA10YO03FM1
SY0AAA13YP06FM1 SY0AAA14YI19FM1 SY0AAA16YE22FM1
SY0AAA16YL16FM1 SY0AAA19YD10FM1 SY0AAA19YD10RM1
SY0AAA1YJ18FM1 SY0AAA1YO23FM1 SY0AAA22YG05FM1
SY0AAA22YG05RM1 SY0AAA22YO09FM1 SY0AAA28YH19FM1
SY0AAA2YC21FM1 SY0AAA31YG18RM1 SY0AAA37YA06FM1
SY0AAA39YB14FM1 SY0AAA41YA01FM1 SY0AAA43YD01FM1
SY0AAA44YG03FM1 SY0AAA46YO05FM1 SY0AAA47YK20FM1
SY0AAA48YO11FM1 SY0AAA49YF04FM1 SY0AAA49YL23FM1
SY0AAA4YP01FM1 SY0AAA56YK02FM1 SY0AAA57YN08FM1
SY0AAA63YH15FM1 SY0AAB12YA06FM1 SY0AAB12YP14FM1
SY0AAB14YC12FM1 SY0AAB16YB20FM1 SY0AAB16YD20FM1
SY0AAB17YB13FM1 SY0AAB18YA22FM1 SY0AAB18YF03FM1
SY0AAB18YK21FM1 SY0AAB22YE14FM1 SY0AAB22YI01FM1
SY0AAB24YK03FM1 SY0AAB25YC07FM1 SY0AAB27YA09FM1
SY0AAB28YF07FM1 SY0AAB31YB23FM1 SY0AAB33YA06FM1
SY0AAB34YM03FM1 SY0AAB35YN14FM1 SY0AAB36YG01FM1
SY0AAB38YA11FM1 SY0AAB39YJ04FM1 SY0AAB40YM11FM1
SY0AAB41YH17FM1 SY0AAB41YJ12FM1 SY0AAB44YB02FM1
SY0AAB44YH04FM1 SY0AAB44YJ22FM1 SY0AAB46YP02FM1
SY0AAB48YI09FM1 SY0AAB49YI09FM1 SY0AAB49YI18FM1
SY0AAB49YI21FM1 SY0AAB49YO07FM1 SY0AAB51YC15FM1
SY0AAB51YE16FM1 SY0AAB51YL04FM1 SY0AAB52YJ02FM1
SY0AAB53YF23FM1 SY0AAB53YP11FM1 SY0AAB55YB03FM1
SY0AAB60YC06FM1 SY0AAB60YC23FM1 SY0AAB61YG17FM1
SY0AAB7YM08FM1 SY0AAC10YL17FM1 SY0AAC2YN16FM1
SY0AAC51YF17FM1 SY0AAC55YP14FM2 SY0AAD12YA14FM1
SY0AAD13YA14FM1 SY0AAD14YM12FM1 SY0AAD36YP11FM1
SY0AAD41YF21FM1 SY0AAD48YH20FM1 SY0AAD49YI10FM1
SY0AAD58YH10FM1