Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1393
Length(NT) : 1838
Best Gene Model Blast : Link to GSTUMT00008462001 E-value : 0.0
Numbers of ESTs : 73

Blast Results:

Nr Definition: hypothetical protein SNOG_04544
Accession: ref|XP_001794959.1| Score: 981 E_value: 1e-104
KEGG Definition: hypothetical protein
Accession: fgr:FG09521.1 Score: 902 E_value: 3e-95
KOG Definition: No Hit Found
PFAM Definition: DHDPS, Dihydrodipicolinate synthetase family. This family has a TIM barrel structure..
Pfam Number: pfam00701 Score: 334 E_value: 1e-31
Swissprot: Q0P5I5|DAPAL_BOVIN

Sequence:
>Contig1393
TTGGCCAACTTTTTTGTACAAAGTTGGCCCACCTCTCCTGTTTTACTATT
CAGCTATATATTCCTCAATTTTGCCTAGGTCTCGCATATATCTGACCCCC
CTCTGCTATTACCGAACACTACCTTAGCCCCACCGTGAATCCCGAACTTC
TCTAAATCATTCACAACTATGCCTCCTCATACCAACGAACATTCCGGACA
TAGCGATAACGACGTCACTCTATCATTAAGCGGTCTTGCCTTACATAGCG
AAGCTGGCGCCCCCCACCTCGGCAGCAATCATCGTGCTTCGAACGGGAAA
AAGAGCAAGAGGAATATCCTTACAGACTCGTATCTGAAGACTCATAGTGG
GAATTTATTTCACGAGACCGATCGTCCTCTTCGTCCCGGGATTTATGCCC
CGACGCCCGCGTTTTTCGATCCTGTCACCGAGGACCTCGATCTGCCCATA
ATCAGAAGTCATTCGGTACGCCTAGTGAAAGCTGGTATCGTTGGTCTTGT
TACTCAAGGTTCGAATGGGGAAGCTGTCCATCTGAGCCAATCCGAACGCC
GGGCTGTCACCGCTGCGACACGGGAAGCTTTGGATGGTGCCGGCTTTGGC
CATATTCCGGTGATTGTCGGTTGTGGGGCTCAGTCCACTCGTGAGTCGAT
CGAGTTATGCCACGACGCAATGCTTTCTGGAGGTGATTACGCCATGGTAC
TTCCCCCAGCCTACTATCGCGCCTTGTACAACGGGGAGTCTCAATACGAA
TTTTTCAGCGATATCGCCACCCAATCACCTATCCCCATTCTCATTTATAA
TTACCCTGGTGCCGTAGCAGGAATTGACCTTGATTCGGACACTCTCACCA
AGCTCTCGAAGCATCCCAACATCGTTGGCTGCAAGCTTACCTGCGGCAAC
ACCGGGAAGCTCGCTAGAGTCGCGAATGCCGCGCCAAGTGGTTTTATGAC
GATGGGTGGGTCCTCGGATTTTACCTTACAATCCTTGATTTCGGGCGGCA
AGGGCGTCATTGGCGGACTTGCAAATATCGCTCCGAGAGCGTGCGCAGAG
GTTTTTAACCTCTACGTTGATGGGAGAAACGAAGAGGCTGAGAAGATGCA
AGCGGTTGTTGCTCGCGGTGACTGGGGCGCGATTAAGGGAGGTGTCGTCG
GAACCAAGAGCTGTCTGCAAACCTATTTCGGATATGGAGGTTTTGGAAGG
CGGCCACTTCCTCGGCCAACTCCTGCTCAGGACGTAGCCTACAAAGAAGA
TTTTCAAGAGTTGTTGCTTTTGGAAGAATTTTTGGAGAACGGATGCCGCG
ATTCTGACATCCACTCTGAGAGAATAAAGGAATTTCCACAACTTGTTGAG
CTCGAACATATGCTTGTATAAGTTCCCTTGCCCTACCTTTTTTAAACACT
CTTAGCAGAACTTTGTTTTTATTTTTTCTCTCTTTCGTATCGTAACATTT
GTTCGATCGTTTGTTGCTTATCCCCCTGGGGTTTATTTATCGGATTGGGA
CTGGGGATTTCATGCGCCTAGGGCTGGGTACCTGGGCTGCTTCGGAGCGT
CACGAGAAAAGCCGCTAGAGATCACACAACTTGGAGTACTTTTTTTTGGG
TTCCCTTTGTCGTTTAGGTTATGCCTTCTCTCTTTCCGGCATCCGTTTTT
CTTTCCAACGTTTGCTCTTTTTTCTTTTTTAATTTCATACTCTCTGCTTG
TCACTTTTCCTTAGGTAGATTGGACTCACAAGAGGAAAGGGGGGGGAGGG
AATTGGAATGGTAGAAAAGGGGCCTGATTGATTGTTAATGTCACGGTTCT
TTCCATCTTATCGTTATATTTAAGGTATTATATCTATG

Sequences in the Contig:

SY0AAA12YA03FM1 SY0AAA31YA21FM1 SY0AAA34YH07FM1
SY0AAA35YC06FM1 SY0AAA49YL22FM1 SY0AAA53YC08FM1
SY0AAA57YB05FM1 SY0AAA60YP11FM1 SY0AAA62YL04FM1
SY0AAA63YA13FM1 SY0AAB18YM23FM1 SY0AAB22YJ06FM1
SY0AAB30YG14FM1 SY0AAB36YG11FM1 SY0AAB47YC24FM1
SY0AAB8YE11FM1 SY0AAC14YI24FM1 SY0AAC15YF19FM1
SY0AAC17YD14FM1 SY0AAC18YH16FM1 SY0AAC19YC24FM1
SY0AAC19YC24RM1 SY0AAC19YD11RM1 SY0AAC19YL24FM1
SY0AAC1YG03FM1 SY0AAC21YN20FM1 SY0AAC23YE22FM1
SY0AAC23YH07FM1 SY0AAC28YG23FM1 SY0AAC2YF02FM1
SY0AAC2YN12FM1 SY0AAC31YO16FM1 SY0AAC33YN02FM1
SY0AAC38YM13FM1 SY0AAC41YI22FM1 SY0AAC47YD03FM1
SY0AAC48YG09FM1 SY0AAC51YJ21FM1 SY0AAC53YD15FM1
SY0AAC58YE09FM1 SY0AAC59YF24FM1 SY0AAC6YN04FM1
SY0AAD11YH10FM1 SY0AAD21YN23FM1 SY0AAD22YF21FM1
SY0AAD29YA06FM1 SY0AAD32YM24FM1 SY0AAD34YE23FM1
SY0AAD3YC16FM1 SY0AAD3YJ19FM1 SY0AAD42YI01FM1
SY0AAD44YA16FM1 SY0AAD44YG12FM1 SY0AAD45YP03FM1
SY0AAD47YE07FM1 SY0AAD48YJ19FM1 SY0AAD51YH15FM1
SY0AAD55YG19FM1 SY0AAD56YI06FM1 SY0AAD57YG10FM1
SY0AAD59YA22FM1 SY0AAD59YM23FM1 SY0AAD5YE02FM1
SY0AAD5YM16FM1 SY0AAD60YB10FM1 SY0AAD60YI16FM1
SY0AAD61YE21FM1 SY0AAD62YK21FM1 SY0AAD6YA24FM1
SY0AAD6YJ24FM1 SY0AAD6YP24FM1 SY0AAD7YF01FM1
SY0AAD7YF04FM1