Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1392
Length(NT) : 1011
Best Gene Model Blast : Link to GSTUMT00002395001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1392
TTGGGTGCATCTGACTCTAGTGTAGAGAGTATGGTAGGAGCCGCACAGCC
ACGCCTAGTCTCGACCTATTCTACGCCGATACTGCCAACAATGCACCGAA
TTTCTCAGCCACTGCCGGAGGGTGTGCAAGGGGACCTCTCCCTCCTTCAT
GAGCACCGGTTGTCCCACGCAGCCGAGGTCGGGCAGCTTCTCCCCCGCCG
TCGCGATACGCTTAGGAATTCACAGATTGTTGGTAACCCTGTGGCTGAGT
CTCCCTCCTCGTATTATTCCCCGGCCACTTCGGACAGAGTATATGCCTTG
GATATTGCGATTCCACCAGCAATGCCAGGGGTCGATGGCCTTCAGTTTCC
GGCACCTGCGGTCACGGTTGGATCATCGGCGAGACCTGAGCGGATAAGAT
GGTTGTCCGATCCAGCGTCTGGTGCGAGCGATGAGCCAATGTTTGACGGT
CCGTGGTTATCCAAGCCAGGGGGCAATGATGACACGGATGGTTCCGCTTC
CCCAAAGACGGCCGATCAATCTGGTCCAACCACGCCAAAATCCAAAGTGC
CGGCGGATTCCTCATCCGATTCAGAACCGGCCAAACAGAAACCTAAAAGG
TTACAAAAGAGGAATAGGAAGAGCCGCGGTAGCCCGTCCCGGAGCTCGGC
TACGGATGTCGACTTGGAGGCCCAACGATAATGGGCGAAGAAGGAAGACG
ATTTGCATCTATTTTGGACGGTTGGGTTTTTTGCATTTTATTTCCCTTAC
TATTCGTTTCTTACCCTCATTTGCACTTTACGGCGTTTGTTTCACTTTTT
TTACACTTTCATGACCGCAACGCTATTGGATTTTGATGAACGCCTATGAG
TTCTTCCTCGTTGGTCCGAGCGAGAAGCCGGCAATACACGTGAGAATTAG
GGAGGGGATCATTAGGCTCCACACAACCTGGCTGGTTTTTTGTTTAAGAG
AAAAGGTCGAGCAGGTTTTATTATGATTTAACTTTTTTTTTTTTTTTTTA
CCTCTTTCTTT

Sequences in the Contig:

SY0AAA49YL03FM1 SY0AAD46YM12FM1