Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1391
Length(NT) : 1106
Best Gene Model Blast : Link to GSTUMT00010234001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: ZIP metal ion transporter
Accession: ref|XP_755537.1| Score: 453 E_value: 4e-43
KEGG Definition: ZIP metal ion transporter, putative
Accession: afm:AFUA_2G12050 Score: 453 E_value: 2e-43
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3907 Score: 310 E_value: 3e-29
PFAM Definition: Zip, ZIP Zinc transporter. The ZIP family consists of zinc transport proteins and many putative metal transporters. The main contribution to this family is from the Arabidopsis thaliana ZIP protein family these proteins are responsible for zinc uptake in the plant. Also found within this family are C. elegans proteins of unknown function which are annotated as being similar to human growth arrest inducible gene product, although this protein in not found within this family..
Pfam Number: pfam02535 Score: 201 E_value: 1e-16
Swissprot: Q5BL29|S39A9_DANRE

Sequence:
>Contig1391
TTGGCACTTCACATCATCTGGACCAAAAGACATCATTTCTCCCCTCACGA
CTAATGAACTTGATGACATCAAACAAATAGATCGCTAACTAACCAACCAA
CCATTGTCACTCGCTTTCTTTCACTCTTTCACTCTCTCACTCTTTCACTC
CCTCACTCTCACTCCCTCACTCCCTCGCTCCCTCTCACTCTCACTTCCCA
AGGTACAGAGCTGCAGCTATAGTTACCGGTATCCTGCCTGCATTATCGTA
ATCCGTGATAACTGCAATCACCATCATGCCAGAAGGCCTCTTCACACTTC
TGCTTTTCTGCATCGTAATGGCCATAACCTCCTTCGGCGCTGGAATGCTC
CCGTTAGCAGTGTCTCTCTCTCCCCCCCAACTGCGCTTGATCTCAACCGT
AGGAATGGGCGTTCTAGTGGGTACAAGTCTGATAGTCATCATACCCGAGG
GTATAGACACCATATACAGCGCTAAGACCTCTCCACCACCAACAATGTCT
TCTCCGTCTGGTCCAATGCTGCGCGGACGTACTGCTGCCGCACCTGCTGC
TTCCTGGTTCGAATATGCAGCAAACCTCCCCCGTCAACCCCGCCATCACT
CCCGGGACGCCAAAGCCATAGAAGCCTCTGACACAAAAACCCACACTACC
ACCACCCCACCACACAGCCACAGCCACGACCACGACTCCGAGCATGAACC
CAAATCCTCCCACTCAGATCCCGAGCCCGAGCATGAGCACTCCACCGAAA
CCGCGCACAAGTGGGTCGGCCTATCACTAATCTCTGGCTTCATCCTAATG
TACTTAATCGACGTCCTCCCGCACCAAGCGCACAAGCACAACCCACAACC
TTACCACATCGAGATCGACAACCTCCGTTCCCTATCCGCCTCCTCGCCCC
CACTAGACAGTCCCTCCCCCTCACATCCGTATTCCAAAACCTCGTCCACC
ACCCTCGGCCTCGTTATCCATGCTGCAGCTGACGGGATTGCCCTGGGCGC
TTCATCGACGAGCTCCAACACTGCCCTGGAGGCGATTGTGTTTCTCGCCA
TTATGCTACACAAAGCCCCGGCGGCATTCGGACTAAGTGCTGTCCTTCTG
AGAGCA

Sequences in the Contig:

SY0AAA13YL16FM1 SY0AAA37YO21FM1 SY0AAA39YA11FM1
SY0AAA49YK22FM1 SY0AAA56YJ19FM1 SY0AAB12YN20FM1
SY0AAC12YA12FM1