Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1390
Length(NT) : 713
Best Gene Model Blast : Link to GSTUMT00009533001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64097.1| Score: 564 E_value: 3e-56
KEGG Definition: chaperone HSP104 and related ATP-dependent Clp proteases
Accession: aor:AO090038000288 Score: 564 E_value: 1e-56
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1051 Score: 444 E_value: 5e-45
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 116 E_value: 6e-07
Swissprot: Q96UX5|HSP78_CANAL
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix

Sequence:
>Contig1390
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCACTAACGTGCCCAAAAATGCTCTCAAGATCAATAGCAATTACTCG
GGCATTCCGGCCCGCAGCCAATACCGCAAACCTGCGAATACGTTCGGTCA
ATCGAATAAATTTACCTCCACTAATCGGGTTAAATAGTTTTCTTAGAGGC
TCTCCCGTTTCTACAATAAGAGGATATGCTACTGCTAGGGGTGGCGGCGG
GCCTCAAGGTCCATTTCCTCCGGGTGGAACACATAGTATGGATCTCGGGG
GCAGTGGGGAAGAGGAATCTGCATTGGGAAAATTTGGCACAGATTTGACC
GCCCGTGCTAGAGATGGGAAGCTAGACCCTGTAATTGGTCGTAACGAAGA
GATCCGCAGGACCATCCAGGTATTGTCAAGGCGGACGAAAAACAACCCCG
TCCTCATTGGCTCGGCAGGAACTGGAAAGACAGCAATTCTAGAAGGTCTT
GCACAGCGGATTGTCAGTGGCGAAGTGCCAGAAAGTATGAAGGATAAGAG
AGTTGTAAGCTTAGATTTGGGACAGCTGATTGCAGGGGCTAAGTACAGAG
GTGATTTCGAAGAAAGATTTAAGGGCGTCTTGAAAGAAGTTTCTGGAGCT
CAAGGGAAGGTTATCCTTTTCATTGACGAACTTCACACACTACTTGGCCT
GGGAAAGACGGAG

Sequences in the Contig:

SY0AAA32YF22FM1 SY0AAA49YK18FM1 SY0AAB2YH15FM1
SY0AAB31YE01FM1 SY0AAB33YJ12FM1 SY0AAC31YE22FM1