Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig139
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00010649001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: bystin-family protein
Accession: ref|NP_596559.1| Score: 154 E_value: 8e-09
KEGG Definition: hypothetical protein
Accession: spo:SPBC13G1.09 Score: 154 E_value: 4e-09
KOG Definition:
Classification: [Extracellular structures].
Kog Number: KOG3871 Score: 246 E_value: 5e-22
PFAM Definition: No Hit Found
Swissprot: O60071|YBB9_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig139
TTGGGGGGAACATTGTGCAGTATTATTGAATCCCTAAAACATCAAAACCA
TTCGCGGAAGCAATAAAACTGCCACGACCCCCAGCCATCCCAGTATCATT
CCTCTAGTGTCACAATCGCTTTATTGTTAAGCAATATGCCGAAAGAAGTT
GCACCTCGTCAGGGCCGACGCCATAACCCGCTACACGACGATCTAGTGGA
AAACGAAAGCGGAAATCTACGGAGAATTGCGCGGTCCAAGCGGAAAGAAA
AGAGCGAAAGTTTTGAGAACTATGTCGACTCTGGGTCATCAAAACGAATT
CTAAAAATTGCTCGAGACCAACAAGATGAACTTCACGAGGAGGAGGCCAG
GAAAAATGCTGCCCAGGGTGAATTCTTTGGATCCGCTGCCCAAATGCGAT
TGCAGGACCAGGAGGAGGAAGAGTCCGATGAGGAGGAGTATGAGGAAGCT
GATTTTGGCGAAGATGATATTGTTGAGGAAGTGGAAGTTGATGAAGGAGA
TATAGAGCTATTCAATCAATTCATGCCATCAGGTCAGGGGGCCGCACAGC
GGATATCTCTTGCGGACAAGATCTTGGAAAAAATTGCAGAGCATGAGGCG
AAATTGGCTGGGCACCCAATAGGGGACGAAGAGACCTCTACCCTACCACC
GAA

Sequences in the Contig:

SY0AAA15YB22FM1 SY0AAB58YF07FM1