Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1389
Length(NT) : 1233
Best Gene Model Blast : Link to GSTUMT00009203001 E-value : 0.0
Numbers of ESTs : 20

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001210060.1| Score: 730 E_value: 4e-75
KEGG Definition: hypothetical protein
Accession: ani:AN9347.2 Score: 642 E_value: 3e-65
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1205 Score: 408 E_value: 2e-40
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 235 E_value: 2e-20
Swissprot: P37959|YUSZ_BACSU

Sequence:
>Contig1389
ATAACGAGTGTTTTGACGATCGCTATGGAGATGGTAGAGGCTGATATTGG
CTTAATTCGCGGTTTAAAAAGGGGGTTTCCTGATCTTTGTTCCCGAATCC
TTCTAGCTAGAATCCATCGCACTTTGGCGCAAATAAACAAAAAGGCAACA
AAACCCTAACCTCTCTATCAAAAACAAAACCTAAAACCTAAACCCCCCAT
CTCCGAATAATAGATCTTTCTCGACAAGACAAACACTTTTATACCGTAAA
AAATAAAGATATGTCTCCAAAAGTTTGGCTCATCACGGGGTGCTCCTCCG
GTTTCGGCGGCTTGCTCGCGAGGGCTGCCCTGAAGAACGGTGATAAGGTG
GTCGCAACGGCTCGTGACCCGAAGAGGATCGATGACCTAAAGGCGCTGGG
AGCCGTAACCCTAGCTCTCGATATCTGCGACGCAGAAGAGAATATCAAAA
AAGCTATCGCAAATGCAAACTCTGTGCACGGACGGATAGATATTCTGGTC
AACAACGCCGCCTACCTCTTGGAGGGAACCGTAGAGGAATCCAGCGCAGC
AGAAGTATTCAAAATCTTCAACACCAATGTCTTTGGGTCCCTGACGGTAA
TCCGCGCAGTTTTGCCCTATATGCGCGCGCAAAGGAGTGGTACTATCGCA
AACATGGGATCCATCGGCGGCGTTAGGGGAACGCAGGGAGCGGGGCTCTA
CTGCTCGACCAAGTTCGCCCTTGCAGGTATCACAGAGTCCATCAAGGCTG
AGGTCGCGCACCTGGGCATCGACGCTGTCTGTATCGAACCCGGCTACTTC
CGCACAAACTTCCTGGCACCAGGACACAGGACCCCGACTGCTGTGCGGAT
CGCCGATTACGACCCTGTTATGGAGCCCATCAGGAACACCTTCGACACGT
ACGACAGAGCTCAACCGGGTGACCCGCAGAAGGGCGCCCAGCTGATTGTC
GAGATCCTGACAAAGTCCGGGAGAGTCGCTGGGAAGGAGGTCCCTGTCCG
TACGCCCATTGGCTCAGATGCTATCGCTTTCATCAGCGCTAGGTCGGAGG
AGACTTTGCAGACTATGAGGGAATGGAAGGATCTCTCTTCTTCCACTGAC
CATGATGACTTGAAGAAGTAGTTGCATTTATTCAAGTTGGGCTTGCTCGA
TACGGCAGTTTCTTATCGAGATATCTTTTTGAATGTTATGGAGATTATTG
TTATGAAAAAGCAATATTTACTTTGTGCAAATC

Sequences in the Contig:

SY0AAA10YE16FM1 SY0AAA13YK23FM1 SY0AAA19YG17FM1
SY0AAA19YG17RM1 SY0AAA35YM13FM1 SY0AAA37YH01FM1
SY0AAA38YL12FM1 SY0AAA41YK11FM1 SY0AAA48YD07FM1
SY0AAA48YK21FM1 SY0AAA49YK13FM1 SY0AAA9YA19FM1
SY0AAB12YE09FM1 SY0AAB36YN14FM1 SY0AAB43YN24FM1
SY0AAB4YC07FM1 SY0AAB51YM18FM1 SY0AAB55YL16FM1
SY0AAB60YO20FM1 SY0AAB6YC15FM1