Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1388
Length(NT) : 1504
Best Gene Model Blast : Link to GSTUMT00011046001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57276.1| Score: 226 E_value: 1e-16
KEGG Definition: prenylated rab acceptor 1
Accession: aor:AO090003000038 Score: 226 E_value: 6e-17
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3142 Score: 121 E_value: 4e-07
PFAM Definition: No Hit Found
Swissprot: P53633|PRA1_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0030134 = Cellular component: ER to Golgi transport vesicle
GO:0042802 = Molecular function: identical protein binding
GO:0006888 = Biological process: ER to Golgi vesicle-mediated transport

Sequence:
>Contig1388
TTGGCCCAACTCTACACTACTCTTCTGGTTGTCTCTGTTCCCCTCGGTAT
CTTTGCTTCTCCCATATCCACGATTCTCTGGCTCATCGGAGCCAGCGGAA
CTTGCATCCTCGCACACGCCAGCTTTATGGACAAACCGATCGAGAATGCT
TTTTCCGAGGAGGCGGTCTAGAGATGGTCTCTCCGCGAACTCCAGTGATG
AAAAGATATGGGCCATCGAAGTCGGCGGGGACGAGGACTGACTTAATACA
CAAGAGATTTGAACCTGGTTTAATTGGTGCTGGATTTATTACTAACGGTG
AAGAGGTGTTTGGCGGTTATATGAGGGGGCACGAGATCGGTGGAAATGGT
TTTGATACGGAGCCGGAGGAGGGTGAGATAATTTCTGACGAGGTGTTGAT
GCAACGGGCCCCGGCGGCCTTTAGGAGAGCGGAATCGAGGCGTGATGGGG
CGGTAGAAATGGAAGAACGGGAATGGCAAGTATGGAACAGGCATCAGGCG
ATGGAGCGGGAGATTGAGAAGCGAGTGATAGAGCGGGAACGGGAGAGGGA
GATACAAAGGGAGATAGAAATTGATAGGCAGCGACAATTGGACCAGCGAA
GACCGAGTCCAGCCCGTAGCGAGCGAATTCACCGAAGCCCGAGCGCGAGC
AGAACTCGTAGTGGTAGCGGCGGGACACGAAACCGAAGCGGAAGCGGAAC
AGGAGGGTATGGATTAGGCGTAGCTAATATGGGGGAACCGGGCTTCCCAG
GAGATAGCAGTTTCGCCCCGGCGGGCTACTCATCCTCCGCCAACTCCTCC
CCTAAAATCTCGCACTCATCCGCAACTTCCTCTTTGCGGCTGGATCGGCC
ATATAGCCGTCAAGCCCGGGATTCTCGAATGATCGCATCATCAGATATAG
AACATCACATGCCCCCTCGCTACGCCCGCGACATCAACCCCTCTTACACA
TCCTTACCTTCTGCCTCTGCCGCTCACCCGCGTGTCACGGTCCCATTATG
CTCAACCATTTCCTCCTCCCCCTATAGAGCAAACCTATCCCCCTCCCCAT
CATTCGTAGAACCAGCATCTACCACTTCACCGTACCGGAGATCCAGCTCT
CTTAACAGAAACGTTGGATCGACGGCTAGTTTCCCGCCTGGGGCAAGTTA
TCATCCGGGAATGCATCCTAGCATACCAGGTGGTTCCGGGTGGGCGGGGA
GTGATCGAGAGGATAGTAGCAGCGGGGGCGGGGGTGGGAGGTCGAGAGTT
AGGAGGGGTTTGTAGTTAGGTTTATCGGTGCTTTTTCGGTCGCCTCTTGT
TAGATTTCTAAAGGGTTTCTTTTGTTTTTGTCCTTGTTTTGTTGGTTTTC
TGATATTTTTCCTTTTTTCTTATCTTGTTTTTGTTATTGTCATGTTTATG
TAGGGTTGGTTGGTTGGTTGTGCGATTAGCGGTGGTTGAAGATGGGGAGT
AAATACATACATTCGGTTTGAAGAGGAGTACTGGTATTGTTGGAGCATAA
TTTT

Sequences in the Contig:

SY0AAA16YA13FM1 SY0AAA49YK06FM1 SY0AAB37YB04FM1
SY0AAB60YE17FM1 SY0AAC18YF17FM1 SY0AAD52YJ03FM1