Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1387
Length(NT) : 754
Best Gene Model Blast : Link to GSTUMT00008558001 E-value : 8e-34
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_00209
Accession: ref|XP_001790902.1| Score: 152 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: ani:AN5224.2 Score: 147 E_value: 3e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1387
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGGTGGGTCCATACTCCA
TCAAAAGCACGAATATTTCATCGGCCGTGAAGCACCCCCACAGAAGACTT
TTCCCTTACTATTGTCAAGCCTGTCGAAAGAGCCTCAGGAGAGCTGGTTT
TCCGCGAACTGGGATCTACCACATCAGTCTACTCCTCACTAACTGCCTAA
AAGTGAGGGAAACAATAACAACGAACGGATCAAGCTTTATTCCACATACT
CGTTGCCTGTGTAATTGAATCCATCATCCACCGTTGGCAGATCATTACTA
GCTTCTTCCCGTTCCTCCATTCCTTTTCCTTCCTGGTCCACCGAGTGAGC
TCCAGAACCTTCCCGAGTTTACACCTGAAACACAACCTCTCCAACCGACC
GTCCATCCGGAAGGATAGGGAGAAAACAAAAAAAAATAACAACCACGTTA
TTTTGATAATAGGAGTACATCGACGTTCTAGGAAGAACCGAAGCGAGAAC
AAAGGGTAGCAATACTTTAAAGAGAAAAGGCGGATCCTCCGGCAAGAAGT
CTCTGCTACGTTGCGAGTCTCCCGCTCGACAATATCAAAGTGGGGAGGAT
AAATTTTTTGGGACGTCGACGTAAGGACGTCGAGGCTAACGGAAGCGGCT
CCATTGCGGCTTCTTTTGAGAAATCGGTGAAGGGTGCCACCAAAGTCAAG
CTTGCAGCTCCAAAATCGAAATATGTTGAACACATCCTTATCGCGACTCA
TGCA

Sequences in the Contig:

SY0AAA18YA17FM1 SY0AAA49YI19FM1