Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1386
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00008734001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An16g07840
Accession: ref|XP_001398083.1| Score: 195 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: ang:An16g07840 Score: 195 E_value: 6e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1386
TTGGAATTACTGAAATGCGCTCCACGTTTGCTTCTCGACGTCCAAAGACG
AGGGTAGTTGCACGAGATGACGAAAGTGAGGAAGAGGAGCAGACAAAAGT
AGTCAAAGCTCCTCCGAAATCAACAGAGCAATCCCAAGGCAGTCTATCTC
GCCCAAAAGGGAAGAAGCGTTCCAGCCTACGGTTATCCTTCGGCTCCGAT
GCTTCCATTGTCGATGATGAAGAAAGAGAGGTCTTTGCTCTCAGAAAGTC
GACCTTAAGCCGGAAAGCGATCGAGAAAAATGCTGCCAGGAAGTCGGGCC
TCTCGGCCGGAGTAATTGGCATGGAGCATCTTAATCTCACACCCAGTATT
GACAGGCCTACATACTCGAAAGAACATCTGGATGAACTGCGGAGCAATAC
ACCTACAATACCATTATCTCAACAGGCAGACTTGGAGGTTGAGGATGTGG
ATATGGATGTTGTTGGAGCGGATGTCCCCGAGACAAACGAGAATACAACA
TTGACTAAATACGGAGAATCGTCAAAACAAGAAACAATTATTCCGGATGA
GGGCTTGGTCAGGGTTATGAAAGCTCGGCGAGCGGAGAAGGCAGCAAAGG
CTAAAGCTGAAGATTACATTTCCCTAAACATTGGTAGTGA

Sequences in the Contig:

SY0AAA49YI14FM1 SY0AAA7YL15FM1 SY0AAB37YJ11FM1