Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1384
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00006001001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001260193.1| Score: 198 E_value: 7e-14
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_2G05710 Score: 192 E_value: 2e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1384
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGACGATACCCCTATGTCC
TCCGCAAACCTCCTCCAAAACCGTACAAACAAAGAATATGCCTATTCGGC
GATCTTCGAGACCTGCTTCTCCGATACTGCGATCCTCGTCTTCATCCCTT
GAGAGCGAGAGCTATGAGCTTTCCAAGCGGATGTCAGCCCCCCCGGAGGA
AGTTGCCCTGGAGGATGAGGAGGAAGATATAGAGGCGTCATCGCCTTCGC
GTGGGCTGCTAGGCGATCAGGACAAGAATCACACTACGGCTGTATCTTCG
CGCTGGCTTAAGTGGTGTGCATATTTGTCATCCTTGAGATTCTGTTATCG
GCGGTGTGGGAATCTACGGCGGAGGTGCTGTCAGGTTTTGACGGTGCTGC
TTTCGGCGGTAGGGCTGTTACTGGTTTTCACATTCGTTTTTAATCCGTCG
TATACGAAGACTCAGTATCCGGAGAATTACGCTGTTGTTGCAGACGCTGT
GCGGAATGGTGGTGGGGTGAACCCTCAAGAGTTTTGGCGCGGAAGAGGGA
AGAAGGCTACAAAGTCGGGACGGGGAAATCCGGCCGGGGAGAAAGTTTTC
ATTGCGGCAAATATAATTGATGCGGGCTTGATCAATGGGGCTTGGGGAAA
TGCTGTTATGGAACTGATGGATTTGATTGGGGGGGAGAATGTATTTTTGA
GTA

Sequences in the Contig:

SY0AAA17YI01FM1 SY0AAA45YF01FM1 SY0AAA49YF22FM1
SY0AAA63YP13FM1 SY0AAA9YA20FM1 SY0AAC22YC18FM1
SY0AAC31YL17FM1 SY0AAD59YI15FM1