Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1383
Length(NT) : 856
Best Gene Model Blast : Link to GSTUMT00011698001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein AN8204.2
Accession: ref|XP_681473.1| Score: 457 E_value: 9e-44
KEGG Definition: hypothetical protein
Accession: ani:AN8204.2 Score: 457 E_value: 5e-44
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG3084 Score: 135 E_value: 5e-09
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 119 E_value: 4e-07
Swissprot: Q9Y7J0|NPY1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1383
TTGGGCTTCTACTCGGGTACTCCTTGGTCGACGGTGCTACCTGTAGTGTA
TATACCGGTACCGGTACCTACCACTCCCCCTACCACTCCCTCTCCCCCTC
CCCAACCACCACTACATTCCACACTACTTGAGCACGAGTACTACATTACA
AAATGACCCAACCCTACACCGCCACAACAGAATCCCACAAAACCTCCATG
CTCTCCCGGAAATTCGGTCAGGAGATAATAAACTACTTCTCCGGCAGCCC
GCTTAACCGTGTCTCCTTCCTTCGCTCAAGCACCGCATTCCTGCGCGCCG
CGCTGCCGCGGTCCAAGTTCCTACTGATGCGGGACTTGGAGCCGCTCGCG
GCGAGCAAGACCACGCTTGCGTGGGTGGGGTACGAGACTGTGCGCGAGCT
CGTAGGGAACCCGTTTGACACGGAGGAGGAAGAGTTTTTGAGGGGCTATG
ATTCTAGGGTTGAGATTCCAACGTTGGTATTTTTGGGGATGAATGAGGAG
GGGACGGGTGGTGGTGGTGGTGGGGAGAGCTTTGAGTTTGAAGGGGAGGG
CGGAAAATATGTTGGAGGGCCGTGCTTCGCTTTGGATGTTACGGAAAAAG
GGAGTTTGAAGGAGGAGTGTGAGAAGGTGCAGGAGGAGGCAGTGAAGGGG
GCGGAAGGAAGAGAGTTTAGGAAAGTTAGATTGGATTTGAGCCTTGTCCC
TTCGGATGCGGCGATACTAGCCCAAGCAAGAAGTCTCCTAGACTGGAATA
ATCGCAATCAGTTCTGTTCAGCCTGCGGCGCCCGGACTGTCTCCGTCCAC
GCCGGAACCAAACGCATCTGCCCACCCTCCGACAAGGCATTCCAAAAGGA
TCCCGA

Sequences in the Contig:

SY0AAA44YA13FM1 SY0AAA49YF14FM1 SY0AAB53YH12FM1
SY0AAC57YE24FM1 SY0AAC62YP24FM1 SY0AAD33YC11FM1
SY0AAD51YJ19FM1