Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1382
Length(NT) : 2068
Best Gene Model Blast : Link to GSTUMT00009252001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: WD repeat protein (possible)
Accession: ref|NP_595934.1| Score: 150 E_value: 1e-07
KEGG Definition: hypothetical protein
Accession: spo:SPBC16H5.13 Score: 150 E_value: 6e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1382
TTGGAATTTCGATGGCATGTACAAGACAGGAAGACAAGTATCTTATCGCA
GCATTTAGTCATCTCTGGTCGGATTCAGGGCGGCAAAGAGCTCATGGAGA
TTTTCTGACGGGCGTGTTCTCAACTAATGCCGCCAGGATGGACATAGAGT
GGATGGAGAAAAATAAAGCCCTCACCTCGTCTTCCTTGATCCAAGATGAT
ATCACGTCATCCTGTTCAGGTATATTTGCCAATATGCTAGCGATCGCTTA
TGGGTCCAATATTCGCCTTCACTCTTTGTCCTCATTTTTACTCTCATATC
ATGATCCCATCAAGGAGATACATATACCTACCACTGCCCGTATTTGCCTT
CTTAAAAGGGTGAGGGTTGGCGAACACGTTGCACATGGCAAGGACGCCGG
AATAAAGGGCGGGAAAGAATATCTCATTGTTGGAACTACTAACGGAGAGT
TGTTCATTATTGAAGCACCCTCATTCCAACTATCGAAAAGACTCCCAATA
TCATCTACAACAGTGCGCTCCGCTAATCTTCTCCTATCAAACCTGGGTAA
GAGACTACGCTTTGCTCTCATCGCCTCCTCAGCAGACGGAACTACCACTA
TAGTAGATGTAGAACGCGCTCACATAATGGTCACTTTTCCGAGCCACGAT
TACACTCCCCTTGTTTCATACGCCACCAAGACCGCGCAGAACATAATCCT
TCTAACCTACGAAGATTACGTACGTCGGGAGTGGGATTTAGGTGAGGAGG
ATGGAGGCGTGCTTAAGGCGCATCCATCATCTCGCGGGAACGATAGAGAT
AGAGGCGCTCTGGGCACATATGAGAGAGACCTTGCAGAGGAGGGGTGGCG
AGAAGTTCGCGTGGGCAAATTCGAACTAGTGGAAGAAGACAGAGAAGATG
AGGGGGATGACGCAAATGGAGATGGTACCATCAAGAATTGCGAGAGGTTA
TGCGAGAGGGGACTTCCGGCCGCCTCCGTCAATGTTCGGGCTGTTCTGGA
TGCATTAAGTCATGCAGTAAAGATAGCTAAAGAACGGACACGAGCTGGCG
AAAGGAGGGTCGTGGGAAATCATCCTGCCCTCATTACTGCCAAGTCACTA
CTTACTTCCCTCGTCCCCGGTGGCATAGAGGAGCTATTGGGCTGGGAAGA
AGATGGCCATGGATGGCGAACTTCGGTTCAATCATTATTCTTCCGGAGGA
AGAAGGCGGCGGTATTCGGGCAGATGGGTGCTGGGAAGAACGTATCCATA
CTGGTGAGGGAAGCCTCCAAAGAAACTGAGGATGGGATATTGGGTATCAG
TCCTACCGTATCCGCATGTGTATTGTTGGCTGCTTTGTCCATTGTGGGCG
GACTACTGGAAGCTAGTGGGAATGGCGAATTCTTTGATAATGTCATAGAA
GGGGCCTTGGGTCGGTTGGCAATCACAAAGAACGAGCCTGCATTAGGGGT
GTTTGCAAAGTACTGGATGGACGAGAATCCAATAATGCGAGCAACCGCAA
GGAAATGTCTTAGTATTTCTGTAGGCACTCTATCCGAGGAGAGGCGAGCA
AACACAATAGCCTACTGGGCACGTTTCTTACCAGTGCAGGTTCCGCCGGA
ACTATTTTCATCAAAAGAAATGGTTCGGTCCGTTATTATTCTTGGACAGT
TAATCACGGCTCACCCCGATAGTGTTGAGCAAGGATTGAAGAAATGCATT
GCGCTGTCGGTTGAATTGCTCCTGGGTGACAGTAACCACTCGTTCCAAGA
CACAGCCATCGAGCTAGTGGGGCATGGTTGGACAACTTTTCAATCCCTCT
TCGACCCCTTTGAAGTAATCCATATCTTGATCCGCATATCCGCCTCGACA
ATGGATGACTTCTCCGAAAACCGGCGAAAGACCCTCAACAAATGCATACT
CGAGATAGCCGAGAAAAATTCTCCTCTTCTAGGATCTGGTCTGGCCAACA
ATATCTCGTACGGTTCGTCTTCTTCTCAACCTGCTGCGTTAGCTGCAGTA
TCGCTCTCAACAGCATTGAGTGTATCTGTTGCCGCGATGAGAATCGTAAC
GATGATAGTTCGTGAGGA

Sequences in the Contig:

SY0AAA16YK13FM1 SY0AAA49YF12FM1 SY0AAD20YL04FM1
SY0AAD21YE03FM1