Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1381
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00005115001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_01676
Accession: ref|XP_001792312.1| Score: 321 E_value: 3e-28
KEGG Definition: predicted protein
Accession: aor:AO090701000131 Score: 297 E_value: 1e-25
KOG Definition: No Hit Found
PFAM Definition: DUF1640, Protein of unknown function (DUF1640). This family consists of sequences derived from hypothetical eukaryotic proteins. A region approximately 100 residues in length is featured..
Pfam Number: pfam07798 Score: 145 E_value: 3e-10
Swissprot: Q4V897|CC90B_RAT

Sequence:
>Contig1381
TTGGCCAGGTCTTGTAACACTCTCTCTCCCTCGCTCATCTCAGAAATCAT
TGGCTTTCCTAAGGTACCGCCATGGCACTGCTGTGGAGCCTATTCCAATA
GCCGATGCACCAAAAAAGGATATTAAATCTAATAGAGAATCTCCGGATCA
GACACGGCCGAAAGATGGAAGCATATCAATACCCAGACTCGCTGGAGAAG
GGACAGAAGCGCCAATCATTTCAATAGATGACTCTACGGTTCCAACAAAA
CCAAGGGCAGGTGGAAAGCCTGTTGAGGTGAACGGGAGTCAACCACAACC
TGCTCATCTTGCACCTCCACCGTTGGTCCACCATTTCGATACCTATGGCT
TGGCAAAGGGTCTGGAAAGCTCGGGCTTCACTAAGGGTCAAGCGGTTACA
GTCATGAAGGGAGTTAGGGGGTTGTTGTCCAATAACTTGGAAGTGGCTAG
GGAAAATCTGGTGAGCAAGAGTAATGTCGAGAACGATTCGTATCTCTTTC
ATGCTGCTTGCAGCGAACTAAGAAATGGGATACAAAACGAACGTAAAACA
CAGATTGACCAACTTCGGGTGGAGGGTGCTAGCATACAGCAGGAGTTTGA
TCTTTTGAACCAGCGGTTTCTGGAGGAAATTATGAGTTTGAAGGATGAGC
TGA

Sequences in the Contig:

SY0AAA49YE24FM1 SY0AAC62YD05FM1