Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig138
Length(NT) : 1055
Best Gene Model Blast : Link to GSTUMT00007384001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 115 E_value: 1e-06

Sequence:
>Contig138
TTGGATACTTTAGAAGAAGCCTCGAAGAGCCGCCAAAACAAAACTCGCTT
CACCTTGGCTATATAAATACGGGCGAAATCACTACTGTCACTCGTATGGA
AGATGATTTTTGTTTCGACATAGGACTATAACTCGCGTTGAAATCACTAT
CGAGAGCGTAGGCGATATCACGCCTGGAACAATTTTTCTTGGTCACTCAA
CTCTTCCGTCCGATTCGCAAACGAAGCGCAGGCCATTTTTGGCACTGTGG
AAGGTCGGGAACCAGACCTCTAACCAGTTTAAAAAACGGGGGTGGCAGCG
CGCAGGCAGCTGCTGAGAAATTCGGACGCACTGAAGCTAGTTTTTACCCC
ATAGCTCCGGAAAGCAATCAACCCTATCTCCCAGTCGCCGCAAGAGAGAA
TTTTCGGGGCTTTATAGATCTCCTAACACCCGTAACCATCGGGCAATCCT
CCCTCGGGAGGAAGAAGTCGAAAGCAACCAAAATCTCCAAGGAGGACTTG
CGAAACGTTATAATGGCACACGTAGGCCTAGTCCAGTGCGGACAAGAGGA
GGCGCTCCTGGCCGGACAAGGGGAACCACCGGAAATGCTCTTGATAGATA
AGAGAACACACGATAACATGCGCCAGATGGCTCTGGGCATGCTCCAGTCC
AGCGAGGATGGCCTTCTACATGCGAGACGCACCCAAGAAGTTACAAAGAG
TCTAGTTGAGGCATTTGATAGACCCCCCGCTGCCAAACTAGTATTACCAC
GTCTGCAAAATCCTGCTCCTTCCCTGAGTTCCTCTTTTGTGGATCAACCA
CCTCCTCCTCCTCCTCATCCAAGGCCTCCGCAAGCTGACACGCGTAGACA
ACCTGGGCAACAGAGTTCAGGCCAGCAACAGCAGCAACAGCAACCCCAAC
AACCTCTGAATAGCCAGTCTGGACCAGCCAGTTGCAGGCCCCGCGCCCCC
CCCGGAGGCCCGAGGAATTCTGATGATGGTGGCGGTGATGATGGGTCTTC
TGGAATCCGCCGCCCCTGGGGTTCTTACAGTTTCTACACCGCACCAACCG
GGACT

Sequences in the Contig:

SY0AAA14YN01FM1 SY0AAA15YB14FM1