Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1379
Length(NT) : 1084
Best Gene Model Blast : Link to GSTUMT00007792001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_05409
Accession: ref|XP_001245968.1| Score: 604 E_value: 1e-60
KEGG Definition: exocyst component protein and related proteins; K07195 exocyst complex component 7
Accession: aor:AO090026000449 Score: 562 E_value: 4e-56
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q4X0X6|EXO70_ASPFU
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck

Sequence:
>Contig1379
TTGGAGTTCCCCAAACCATCCAAAGATAGCTCACAACCAAGCTCCCCCAC
ATTAATTGACAGGGGGAAAAGGAGTTCATCATTACCGTCATGAATGGTCT
TCGCATGGACGAGCTTTCCGCTGAGGTCGAGGTCTTGGAATCGAAGCTAT
CCAAGACTGCAGACCTCTCCACCAAGATCGCCCTAAGCTTGAAAAAATTA
TCAGCAAGTGCACAGAATGTCGAACAGGCAGTTAAACCTATATACAACAA
GACGCAGTCGTTAACAGTCCTTTCCGGGAATATCGATGAAGCAATATCGG
CAATAGATAGGGTGCGCCAACCTACAGACGCAGTATCGAAAGAGGAGGGC
ACAATTCGTCAAGGGCCTTCCAAGACCGGCCTAACTGAATACCTCGCCTC
GCTAAGACGGATCAATGAGGCTCTATCGAGTCTGAAGAAATCGAACTTAC
GAAGCTCTCAGAAAGCCGTTACTCAAATGACGGGCCTTTTGAAAGCGGGG
AGCCTACAACTCGAAGACCTATTTAGACAAGCATTAGCCGAAGGTTCTAA
ATCTGTAGAACCTCTACATTTCATTACCAAAGAACTTCCGTTTCCGACTT
TCCAGCCCCAGAAAATCAACATGTTGGCTGTACTGAACGATTTCCTTTCC
TCGACCCTTGCTGCCTCAGCTGGGATACAGTCAAATGCGCCCCAGGTATA
TGCAGAAGTGCGTGGGCCCTACATCACCAACTCATTGGCATCCCTGGCTT
TGGCTACAGTAAGCACTACCCGCCGAACATCTGCTGCTCCTTATGACAAG
GGGTCAAACGGCATATCGGTGTATACCAATGCCCTAGAAGCTATTTTTGA
GGCTGAATACGAGAATATCTGTCAACTCTTCCCCACCCCAGAATGGTCTC
GGGTGTACATTGCTACAACTGCAATGCCTATGGGAGTATTCAAAAAGACA
GTTGCAGATCTAAACGTGTTCGTCAAGCAAAATATGGCCACGGACTGCTT
CCTTGCTTTTGATGTTATCGAAAACGTCCAGCCGGCAAGCGTTAGGCTAA
AAACTAAAACAGGTGAACAAAAGGAGTTTGCTGA

Sequences in the Contig:

SY0AAA38YG15FM1 SY0AAA43YK17FM1 SY0AAA49YE07FM1
SY0AAA7YN24FM1 SY0AAB34YG24FM1 SY0AAC41YL23FM1
SY0AAD48YL22FM1