Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1378
Length(NT) : 866
Best Gene Model Blast : Link to GSTUMT00006134001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: C6 transcription factor, putative
Accession: ref|XP_001265276.1| Score: 131 E_value: 6e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 111 E_value: 3e-06

Sequence:
>Contig1378
TTGGCCGGCGTCGTGCCACCGACTCTGGCCCTGCCATTATCTCCATTATT
TGCGGATGGGAACCCTCACGGAAAGGCTATTACCCCCCCGACTCTCGCCA
GGCCTTCTCCTGGCCAAAATCGAAGGAAAGGCCCTCCTAGGATTGTGGCA
TGCGTCTCCTGTCACAGACAGAAGAAAAAGTGTGCGGGGGAACGGCCTTG
TGCGCGCTGTGTGGCTCTCGGGGTAGCCTGTAAGGAACAAGAAAGGCCTG
ATGATGGATTTCAGTACATTCGGAAGAAGAAGAAGTTGAAAACCGCGAAA
ACCCTGGATCCATTACCCCAGCTTCCGCTTCACCCTCTAAACCATCCCAC
CCCCTTTCCGGGTAGCTTGTGGACCTCCATGGGCCAGCAGGCAAGTCATG
ATAGCCCGGCTTATCAGAACCAACTTCCGTCGCCTTCGCCGTCGTTGACA
ATGATCCCGGTGGAAATGATGAACGTCGTGACCGAAGCCCACAAGCGGCC
AGTGGTGACGTGACCCAATGCGACGATGACGAATCAACTCCAACACCAAC
CCCAGTCTCGATTGAAGCACCCCCTTCTCCATCCCCCGAGCCAGACTCAG
TCGCAAACCAGCCAACTTCACACCCCATTTCTGACTATTTTGGCACTGCT
CCTGAAGCCGTCTTTGGTCCAGCTAATCTCGACCTTGGCCTTCTCGCTGA
CTTGGAGGCCGACCTTGAATTGGACCTTGAGTTGTTTGGGTCCCCTGAAA
ACGAGGGTTCTTCACTAGGTGGTTGCAACGCTGTTGGTACCCCAACTATT
AGCGAGCAGACTGAGAGTACAACTCAGTTGGGCGAAGGTGGGGGGGGTGA
GACTGCCGGTAGCGGT

Sequences in the Contig:

SY0AAA35YB11FM1 SY0AAA38YK08FM1 SY0AAA49YD22FM1