Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1377
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00006874001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57498.1| Score: 579 E_value: 4e-58
KEGG Definition: polyC-binding proteins alphaCP-1 and related KH domain proteins
Accession: aor:AO090003000297 Score: 579 E_value: 2e-58
KOG Definition:
Classification: [RNA processing and modification, General function prediction only].
Kog Number: KOG2190 Score: 216 E_value: 1e-18
PFAM Definition: KH_1, KH domain. KH motifs can bind RNA in vitro. Autoantibodies to Nova, a KH domain protein, cause paraneoplastic opsoclonus ataxia..
Pfam Number: pfam00013 Score: 133 E_value: 5e-09

Sequence:
>Contig1377
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCGTCTGGCTCGTGTCTT
CCTCTTTCTACCGAGCGTTCCTTGGTCGTTCTTGGTGTTGCTGACGCGGT
TCATATCGCGACGTACTATATTGCCAATACTCTTGTGGAACAATTGACGG
AGCGTTTCGGCGGCCCTGCTGCGTCTGCGTATGCGACTCGTTCTGGTGGG
CCTGCCGGCCCGATGCCTGGTGGGATGCAAGTTGTCCCATACCAACCACA
ACCTCTTCATGGATCTTATGGAAATCCTGACACTTACAAACGCCACAACA
ACAATGCCCAGCGGACCCCCAACAATCCTTATGGGATTCCCTACCTCCAT
GGGCCGGCCCCAGCTCCGGTCCCCCAGGCTCCCATCCACTATGCTGACCC
TCAGGCCGCTAGTGCCTATTCCGGCGCTGGCCCTCACCAACCCGGTCAGG
CTGGAGCTGGACCCACTCCTCAGCAGGGGCCTGCGCCTAATCCTATGGCT
AACATGTTGCCCGGCCAACCGCTTACCCAACAAATCTTCATTCCTAACGA
TATGGTGGGAGCCATCATTGGAAAGGGTGGAGCCAAGATCAATGAGATTC
GACAATTGTCGGGTAGCGTCATCAAGATCAATGAACCTCAAGATAACAGC
AATGAAAGAT

Sequences in the Contig:

SY0AAA49YC21FM1 SY0AAD51YK10FM1