Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1376
Length(NT) : 1054
Best Gene Model Blast : Link to GSTUMT00003031001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_07251
Accession: ref|XP_001591805.1| Score: 134 E_value: 4e-06
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG4259 Score: 163 E_value: 4e-12
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 138 E_value: 3e-09

Sequence:
>Contig1376
TTGGATTTTCTATCAACCACAACTCACCTGCCATCCACCCTCCCACCATA
ACTTTTCCTCAGCGGAAACGAACTCATCAACCGTCGCCATGACCGACTAC
TCAAAACTCAAAGTCCCCGACCTTCGTGATGCCCTCCAAAAGCGCTCGCT
CCCTACTAACGGCGTCAAATCTGACCTAATCGCGCGTCTTGTGGCATCCG
ATGCTGCCGCTGCACCTACACCAGCGGCTGAAACTCCAAAAGCCGCTGCT
CACCTACCAACTGCTGATGACTACGAAGTTGACTGGGAGGACAACGACGA
GACTGTTCCCGCAGCTCCCACTGCTGCCACCATTACCGCGCCGGCTGCTG
CGACTACTACTACCACCACTTCAAAACCTCCAGCCACAACCTCCGCGCCC
AAGGCCGAAGCCGCCAACTCCGCTGCTACCTCCACACCCACACAACCAGA
GAAGCCCAAGAAGAAATCAATCGCATCTTTATTCGACGCTCCGGTGAAAA
CCACCTCTCCCTCCTCCCCTTCCACCGTTACAGATGACAACACAACCTCC
GGCACCCCTGCCGCCACTACCAGCGCACCCGAGAAGTCCTTCACAGCAGG
TCTGAAATCCTCCGACGCAGCAGCCGAACTCGCCAAGAAGAAGAAGCGCG
CGGAACGCTTCGGCGTCATAGACACCGAATCCGAGAAGATGCTCGAGCGC
GCGAAGAAGTTTGGTGCTGTTGAGAATGCGAGCCTAGTTGTTAAAGGTTT
AGACGCCGCCCTGCCGGATAAGAAGGAGAGGCCGAAGCGTGGGCGTGAAG
GGGCCGATGGCGGGGATCGTGGTGGGAAACGTCCTCGTGAGGGTGGCTCG
AGGAGTGCCGGGGGTAATGATGCCCGGGGGCGTAGGAGGAGGAGAGGTCA
GGGTGGGAACAATAATGATAAGAAGGGGAACAGCAATGGTGTACTCGCGG
TTCGTGGCGGTGGGCCCGTTACCAGGAAAAATGTCCTGGACGACCCCATC
GAGAAGGCGAAGGCAGAGGCCAGAGCGAAGAAGTTTGGAGCCAAAAACTA
ACCC

Sequences in the Contig:

SY0AAA49YB18FM1 SY0AAA55YE11FM1 SY0AAB21YL16FM1
SY0AAB56YI05FM1 SY0AAD35YM16FM1 SY0AAD43YC20FM1