Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1375
Length(NT) : 1344
Best Gene Model Blast : Link to GSTUMT00000603001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein SS1G_09488
Accession: ref|XP_001589766.1| Score: 475 E_value: 2e-45
KEGG Definition: hypothetical protein
Accession: ani:AN1753.2 Score: 462 E_value: 2e-44
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG4039 Score: 339 E_value: 2e-32
PFAM Definition: HIM1, HIM1. HIM1 (high induction of mutagenesis protein 1) plays a role in the control of spontaneous and induced mutagenesis. It is thought to participate in the control of processing of mutational intermediates appearing during error-prone bypass of DNA damage..
Pfam Number: pfam08732 Score: 113 E_value: 4e-06
Swissprot: Q5BCH7|FMP52_EMENI
Gene Ontology:
GO:0005741 = Cellular component: mitochondrial outer membrane

Sequence:
>Contig1375
TTGGCAGACGCCTCCCCCCCCTCTTATTCCTCTCGTTCGGGTCCTTCCTG
AGTTCGATTCTTCCTTTGTTGGACGGAAACGCCCGGACCGATCGTTTCTC
TCTGCTCGAGTCCTCCTTTTCACAAATACTCGTACTTAGCGGCCATCTTC
TGTCAAGGCAAAGCGTCCCGCGAATCCGGCGGAATTTGCCCTGCATCCGC
ATCAGCACAGTTGCTCCAGATCTTGCCGATACGTAAACAGATCACAACAT
GAGTTCCGCAAAGTCTGTCTCAATAGCTGGGAGCACGGGCCTGGTGGGCT
CCTTCGCGCTCCAGTACTTTCTCTCGAGCCCGCAGACTTCCCACGTGTAT
TCCTTAATGCGCCGTCCTTATCCTCACCTAATTACCGACCCCGAATCAAA
GCTTAAACCTCTCATCTCGAGTGACATCACGACATGGGCTGCAACTCTTG
GTTCTATCCCCACTACCGTGTTTGTCTCTGGCCTTGGAACTACCCGCAAG
GATGCCGGCTCTTTCGAGTCTCAGCGTAAAATCGACTTTGACCTTAATCT
TGATCTAGCAAAGGCAGCCAAAGCAGCCGGCGCAAAAACATACGTTTTGA
TCTCCTCCACTGGCGCAGACTCAACATCTCGGTTCCCTTACATGAAGATG
AAGGGAGAGTTGGAAGATGCGGTTATCGAGATAGGGTTTGAAAGGACGGT
AATCCTAAGGCCAGGGTTAATTGTCGGCTCACGGGAGAAGACTAGGTTGT
TGGAGTACCCGCTCCATGGTGTGGCCAATCTCCTTGGTGCTATCTCGGGT
GGAAAGTTGAAGGATGGGTGGGCTCAGGATGCAGATATTATTGGGAGGGC
TGCTGTCAGGGCCGCCCTGGAGGAAGGTGTTTGGGAAGGCAAGGGGAAGC
AGGAAGGCGGAAAGACGGTTTGGCACCTCACGCAAGCTGATATCGTTGCT
CTTGGGAAACATGCAACATCTTAAGTGATAAATCACAGCGCTCGAGTACT
CGAGTATTGGGTGGGAAAGGTATACTCGAGTACCTAGTGCGGCTGCAAGT
GCTTTTATGTGTTTTTCTTTTTCTTTCTTTCTTTTCCCTACTTTCCCCGG
CTATGAGGGCTCACGGGCTACTCGTACTTTTGCCTAAGTACAGTAGTTAC
GACTTAATGCTGCATAATATCAAATTGAACTACCAGTGCAAGTACTCAAG
TACGTCGACCCATACAGACATAAGCTATATCTTTAATGTTTGCTTCAATA
ATTGAAACTCATTTTGAATGCATTTTTTCATCACTCACTTGGGTCATTTC
CTAGCAAGATGCGTATAAATAAATTATATTGAAGTATAAAGAGC

Sequences in the Contig:

SY0AAA45YM13FM1 SY0AAA49YA10FM1 SY0AAA57YJ15FM1
SY0AAA62YF20FM1 SY0AAB35YG17FM1 SY0AAB35YN04FM1
SY0AAB42YG11FM1 SY0AAB44YG13FM1 SY0AAB48YK12FM1
SY0AAC11YA07FM1 SY0AAC19YF22FM1 SY0AAC19YF22RM1
SY0AAD30YO19FM1 SY0AAD34YL05FM1 SY0AAD39YP12FM1
SY0AAD53YG09FM1 SY0AAD57YI13FM1 SY0AAD63YB09FM1