Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1373
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00004287001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65057.1| Score: 898 E_value: 5e-95
KEGG Definition: vesicle coat complex COPI, beta' subunit
Accession: aor:AO090011000577 Score: 898 E_value: 2e-95
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0276 Score: 807 E_value: 5e-87
PFAM Definition: Coatomer_WDAD, Coatomer WD associated region..
Pfam Number: pfam04053 Score: 615 E_value: 9e-65
Swissprot: P35606|COPB2_HUMAN
Gene Ontology:
GO:0030126 = Cellular component: COPI vesicle coat
GO:0005515 = Molecular function: protein binding
GO:0006891 = Biological process: intra-Golgi vesicle-mediated transport
GO:0006890 = Biological process: retrograde vesicle-mediated transport, Golgi to ER

Sequence:
>Contig1373
TTGGGCAAAATGGGACTGTTGAGGAGGATGGCGTTGAGGCCGCCTTCGAA
GTCATCACGGATATCAATGAAACGGTTCGCACCGGAGAGTGGGTCGGTGA
CTGCTTTATTTACACCAACTCCACAAACCGCCTGAACTACCTCGTTGGTG
ATCAAACCTACACTATCTCTCACTTCGATCACCCTATGTACCTCCTTGGA
TATCTTCCGCGCGATGGTCGCATCTACCTTGCTGATAAGGATGTTAACGT
TCTTTCCTATGCTTTGTCACTCAGAGTAGTAGAGTACCAAACTGTGGTTC
TGCGTGGCGATATGGAAGCTGCTGCGGAGATTCTAGGTGATATCCCAGAG
GACCAGAAGAGCAAGATTGCTAGGTTCTTGGAGGGGCAGGGCCACAAAGA
TTTGGCATTGGAGATTGCCACAGATCCCGAGCATCGATTTGACTTATCGC
TATCGCTTGGAAACCTCGATACGGCCTTAGAAATCGCTAGAGAGGCCGAT
GCAGAACATAAATGGAAGACTGTGGGTGATGCCGCCCTACTAGCGTGGGA
TTTGGTCCTTGCGGAGGAGTGTTTCAGGAATGCTAAAGACATTGGCTCAC
TACTTCTCTTGCGCACTGCGACCGGCAATCAAGAGGGTCTGAGGGAACTC
GCAGGTTCTGCTATCATTACTGGGGCCAACAATATCGCTTTCGCTGCTTT
ATG

Sequences in the Contig:

SY0AAA42YM23FM1 SY0AAA48YP13FM1