Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1372
Length(NT) : 1319
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2204 Score: 116 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1372
CCTAACTTCACTGCCGGTGTGGTTTAAATCACTCTCTCACTCATCCTCAA
CCTCTTACTCTTGCGAGAATTTGATTTTCGTCTGCACATGACCGCTTCCC
TATGCTGATTATCGCCTCACTTGTCCCCGGGGCTCTGGGATTGGATGTTC
GGTGCTTCCAGCCGAGACATTGAAATATCTCTATTTGACGTTCACTAGTG
AAGACGTTGGGAGCCTGGACGAATGGGTTTTCAGCACCGGTAAGCGCCTA
TTTTCTTATGTTAGGTGCTTTTTTACTCCCTTTTCTTTTCTTCCCACAAA
CGAACAAAACGATTACTTTTTGATCTTCCGGTTTCCCCTGCCTTGCCTTG
TCTGTCCTGCCCTGTCTGCTGTTGGTGGAAAGTGTTTACTCTGACACTTT
TCACTTAACTCCAATATCACACACACAACACTGCGGCAATACACTCCAAC
AACCCCCTTTCAACCTCCGGAATGTAATCATTTTATTACATTACTTTGGA
ACCTTCTATCTGTTCCTTTTTTTCTTTTTCTTAGCACCCGACCCATCCAT
CCATCTTGCCTTTTGTTCGTTCGCCTCCACTTGTTTCGTTCATCCCTCAC
GCCTTACCTCACATCTTCCTTCCCCCTCCCCCCGGCAGTTCTGTGTAGCG
AAAAGCGAGAACGGGGATAATTGCTTTTTTTCTTCTTCCCCCTTCTCTCC
CTTACTCACTCAGCTCCATGGGTTGGTTTTCGATATTATCATATTGCGGT
TTGCGAAAACCTTCACCAAGAAATCGGGCTTGAGAAAAAAAACCGCACGT
CTTAAATCCTCTCTCAAACGGACTCGAACGCCAACCCGCTAGTTTCTCGC
CAAAATCAGGTCTGAGGCAGCCCTGATAGTCCAAAGGTTACTCAAAGGAG
GCTCTTGTCTTATTTCCGGCACGTTTCGAGGTATCCCGAGATGCGATTTT
TTCTCAAGCCCAGTTTCTTTATGATTTTCGTAAATCGCGATATATCGATC
ATGAGGTATCATTTACCTTACCTCACCCTTACTCGTACAGTACCATCCAT
CCATCCCACCATCAATTCCAAATAAGCCATGGCTCACTAGCCCCTCCCCA
TGTTTCGCACCGACGCCTCATCTCCCTTCCCGCTCTCCCCCTCTTTCCCT
GCTATCTTTTTCCCCTTCCTTCCTTACAAACATACATTCATATATCATAC
ATATACACATACATAATCGAATTCGGGAAGAGGGGGGTGGTTGAACGATA
CCTATTCTTGTTTTTAATTATTTGTTTTGCCTTTTTTCCCACTTTTTTTT
TTCCTTTTTCCTTTTTTTT

Sequences in the Contig:

SY0AAA33YE10FM1 SY0AAA46YA21FM1 SY0AAA48YH17FM1
SY0AAA48YP09FM1 SY0AAA63YK10FM1 SY0AAC19YK08FM1
SY0AAC62YK10FM1