Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1371
Length(NT) : 911
Best Gene Model Blast : Link to GSTUMT00011156001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_00911
Accession: ref|XP_001791578.1| Score: 752 E_value: 6e-78
KEGG Definition: structure-specific recognition protein, putative; K09272 structure-specific recognition protein 1
Accession: afm:AFUA_7G05360 Score: 747 E_value: 1e-77
KOG Definition:
Classification: [Transcription, Replication, recombination and repair, Chromatin structure and dynamics].
Kog Number: KOG0526 Score: 568 E_value: 3e-59
PFAM Definition: SSrecog, Structure-specific recognition protein (SSRP1). SSRP1 has been implicated in transcriptional initiation and elongation and in DNA replication and repair..
Pfam Number: pfam03531 Score: 122 E_value: 2e-07
Swissprot: Q4WGK6|POB3_ASPFU

Sequence:
>Contig1371
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCCTCCCTTCCCTTCTCC
CATCAAAGCCACGCACACACACCCAGGGTGAAAAAAAAAGGATAAGAGGG
AAAAAAATACCGCCCTCAAATCAAAATGCCGTCAGACATCGAGACCTTCG
AAAATATCTTCCTCGACCTCTCCCGTACACCGGGTCGTTTCCGCTTCGCC
CCGAGCGGAATGGGCTGGCGTCCGACCACCGGCGAGATCTGGAAGATGGC
AAATACAGAGCTAAGTACGGCACAGTGGAGCCGTGCGGCGCGCGGGTACG
AATTGAAACTTTTCACACGAACCATGGGGATTGTGCAGTTGGATGGGTTT
GAGCTTGATGACCTAGATAGGGTCAAGGAATGCTTAAAAGCATACTACAA
GGTCAACCTCGAGCACCGCGAGCACGCGCTGAAGGGCTGGAACTGGGGCA
AGGCCGAGTTTTCAAAGTCAGAATTGTACTTTAATGTTGCCAACAAGCCC
GCTTTCGAGATCCCCTTCGCCGAAGTGTCGAATTCGAATCTTGCCGGGAA
GAATGAGGTCGCGGTCGAGTTCGCTACCGCTGATGCGGGCGGCGGCGGAA
CGAACGAGGCTGGGAATAAGAAGAAGAAGAAAGCTGCGGCGCAACTGGAC
CAGCTTGTTGAGATGAGGTTCTATGTTCCGGGGACCGTAAAGAAGGGGGA
TGAAGAGGCCGGTAGCGATGCTGAAGGCGAAGAGAAGGAGATGAGTGCTG
CGAATCTGTTTTATGATACACTTAAAGAGAAGGCCGATATCGGAGAGGTG
GCGGGAGATACCTATGCTACGTTTTTGGATATCTTATTTCTTACTCCTCG
AGGTCGTTACGACATAGACATGTACGAGTCATCCTTCCGCCTGCGCGGGA
AAACCTATGAC

Sequences in the Contig:

SY0AAA48YO08FM1 SY0AAC13YG02FM1 SY0AAD60YG03FM1