Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1370
Length(NT) : 827
Best Gene Model Blast : Link to GSTUMT00003887001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001217155.1| Score: 520 E_value: 2e-75
KEGG Definition: TFIIF-interacting CTD phosphatase, including NLI-interacting factor (involved in RNA polymerase II regulation)
Accession: aor:AO090012000927 Score: 510 E_value: 3e-74
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1605 Score: 415 E_value: 2e-41
PFAM Definition: NIF, NLI interacting factor-like phosphatase. This family contains a number of NLI interacting factor isoforms and also an N-terminal regions of RNA polymerase II CTC phosphatase and FCP1 serine phosphatase. This region has been identified as the minimal phosphatase domain..
Pfam Number: pfam03031 Score: 407 E_value: 1e-40
Swissprot: O59718|NEM1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1370
TTGGGCGGCTTACAAAGTATCCACGGAGCTCGGGACCCACCAAACCACTT
CTCCCTTCCCATCCTTCTCCGAAGACATTGATCTTGGATCTCGACGAGAC
ATTAATCCACTCACTCGCCAAGGGGGGAAGGATGACTTCCGGTCACATGG
TGGAGGTCAAACTCGACCGCCAGCATGCGATCCTATATTACGTTCACAAG
CGCCCTTACTGCGATGAGTTTCTCCGAATGGTATGTCTTCTAAGTATTCT
ATGGTAGGTGTGGGCAGGGTCTGACATAGAGGGTGCGTAATGATTCAGGT
CTGTAAATGGTACAACCTTGTGATATTCACAGCATCTGTGCAAGAATATG
CCGATCCAGTAATTGATTGGTTGGAGCAAAATCGAAAGTACTTCAAAGGC
CGTTATTATCGTCAACACTGCACGCAACGTGGTGGTGCTTACATCAAGGA
TATCAGTGCCGTGGAGCCAGACCTGTCTAAAGTTATGATAATCGACAACT
CACCTATGAGTTATATTTTTCATGAAGATAACGCAATCCCGATTGAAGGA
TGGATTAACGACCCTACCGATATCGACCTTTTGCATCTGATTCCATTGCT
TCAAGCATTACAATATGTCACCGATGTCAGGGCTTTGCTAGCTCTACGAA
TGGGCGAGATTGATTGATTTGCTGAGCGTTTTTTTTTATCATACGGAGGG
CGTTAATCTCTTGGTTTCTGGGGGCCGTTGATCCTAAGTTGTGACGCATT
GGTAGGGGCTGATGCTAGCGCTTGTTGTCGCTTTTTTTTACATCATGTTT
TCACCACATTGATTCTTTACTCCATTC

Sequences in the Contig:

SY0AAA48YO02FM1 SY0AAC31YN24FM1