Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig137
Length(NT) : 1061
Best Gene Model Blast : Link to GSTUMT00002293001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG10114.1
Accession: ref|XP_390290.1| Score: 700 E_value: 9e-72
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG10114.1 Score: 700 E_value: 4e-72
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0395 Score: 571 E_value: 2e-59
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 542 E_value: 5e-56
Swissprot: Q01387|RAS2_NEUCR
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig137
TTGGTCGCCTTCCGTTGCGATATAAAAGTCATAAAGGGGTTTTCAAACGT
CCAAAAGCAGTGCCGTCTGTCGCGAACCCTCGGGTCCGGTTCATCAAGTT
TACATTGCTGTCCCTGACATCAGTTGGGTTAATTGATTGAATTAAACGGC
TCTTGACCTTTCGGTTGGTGTTAAGATGGCGACTCGAATGACATTGTACA
AGTTAGTTGTATTAGGGGACGGAGGAGTGGGGAAAACCGCCTTGACGATA
CAGCTTTGTCTGAATCACTTTGTCGAGACGTACGACCCTACAATCGAAGA
TTCCTATCGGAAGCAGGTAGTCATCGATAACACTGCCTGCATGTTGGAAG
TACTAGATACCGCTGGTCAGGAAGAGTACACAGCGCTCAGGGATCAATGG
ATCAGGGATGGCGAAGGATTTGTGCTTGTATACAGCATCTCCTCCCGATC
AAGCTTTACCAGGATACCACGATTTCACGGGCAAATATTACGGGTGAAGG
AATCTTCAGCGACTGGTGGAAATTACTCCGCTAACAATAATGTTCCGATA
ATGCTTGTGGGCAACAAATCCGACAGGGTCACTGAACGAGAAGTCTCGAC
ACAGGAAGGCCATGCGATGGCTAGGGACCTTGGATGTGAATTTGTTGAGG
CTTCCGCGAAGAATTGCGTGAATGTCGAGCGGGCGTTTTACGATGTTGTG
AGGATTCTCCGAAGACAGCGACAAATCATTGCGAAGAGGACTCAAGGCCC
TGGCATCAATGACGGAAATGAACCTCAAAGTGGCAGACCCGGTGGCAAGA
ACAGGAGAGGTCCTGGAAGGGGGAGGAAGCCTGTTTGTATCATTCTGTGA
ACGTGTTTCGCTTAGTAGCTAATGGGTACCTCTCTTCTACCTTTTTGTTA
TTTCCCATAGCTCGAGGTGAGTCTTACAAACACTTGAACAATATGGAACA
CTTTGTTCACATTTCATCTTGATTTTCTTTGCAAATGGGAGGGTATGTTA
CGTATGAAGTTACTATTTTTTTATATCTTTTCTCCCTTTTTATTTTCACG
TCAATTTTTAC

Sequences in the Contig:

SY0AAA15YB10FM1 SY0AAC25YF09FM1