Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1369
Length(NT) : 852
Best Gene Model Blast : Link to GSTUMT00010265001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: mitochondrial tricarboxylate transporter (Ctp), putative
Accession: ref|XP_001263903.1| Score: 628 E_value: 1e-108
KEGG Definition: mitochondrial tricarboxylate transporter (Ctp), putative
Accession: afm:AFUA_3G05420 Score: 627 E_value: 1e-109
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0756 Score: 437 E_value: 5e-44
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 232 E_value: 3e-20
Swissprot: O13844|YFG5_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1369
TTGGGCCACAGACAGAGCAAAAGAGAAGCCGAGCGTTACTCGTTCACTTA
TCGCAGGAGTGCGGGGGCGATCGAAATTGCGATTACCTATCCGGCGGATT
TTGCGAAAACGAGAACGCAGTTAAATCGTCGACTAGCCACTGCGGAGAAG
CTTCCATGGCCCAAATTTGGAAAGGAATGGTATGCGGGGTGCACTACGGC
CATAATTGGCAACTCTATTAAGGCGGGCATTCGTTTTCTTGCATTCGACG
CTTTCGTTAGTCTCTTCGCGGACGAGAACGGAAAGATTAGTGGACCAAGA
ACTGTCCTTGCAGGGCTTGGAGCTGGTACTACGGAGTCGTTGATCGCCGT
CACACCGTTCGAAAAATCGACGATCGTAAATCCGGGAAACCACGAATGCG
GGGATTTATTCACGGCTCTAGAGTTATTTGGAGGGAGAAGGGGTATCGTG
GTTTCCTTCAAGGTCTGGTGCCTACCACTGCCCGTCAAGCCGCAAATTCT
GCCGTGAGATTCGGATCGTATACTACTATTAAGCAGTTTGCGCAAAGCTA
CGTCGCCCCGGGTGAAAAGCTTGGCCCATTATCTACCTTTGGAATTGGGG
CAACGGCTGGCTTAATTACAGTCTATTGTACCCAACCTCTGGATAGCATA
AAGACTAGGATGCAATCAATCTCTGCCCGTACAGAGTATAAGAATAGTTT
TCATTGCGCGTACAGAATCTTTACGGAAGAGGGAATACTTGCCTTCTGGG
CTGGTGCCTTGCCCAGGCTAAGTAGATTAATGATTAGCGGAGGTCTTGTT
TTTACGATGTACGAGAAGACGATGGAGGCGTTCGATAAACTCGATCCCGA
GC

Sequences in the Contig:

SY0AAA42YC13FM1 SY0AAA48YN21FM1 SY0AAC39YG21FM1