Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1368
Length(NT) : 1037
Best Gene Model Blast : Link to GSTUMT00000979001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein MGG_01067
Accession: ref|XP_368177.1| Score: 656 E_value: 1e-66
KEGG Definition: hypothetical protein [EC:2.5.1.-]; K06125 4-hydroxybenzoate hexaprenyltransferase
Accession: mgr:MGG_01067 Score: 656 E_value: 5e-67
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG1381 Score: 759 E_value: 3e-81
PFAM Definition: UbiA, UbiA prenyltransferase family..
Pfam Number: pfam01040 Score: 430 E_value: 4e-43
Swissprot: Q298G6|COQ2_DROPS
Gene Ontology:
GO:0005666 = Cellular component: DNA-directed RNA polymerase III complex
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0008412 = Molecular function: 4-hydroxybenzoate octaprenyltransferase activity
GO:0016094 = Biological process: polyprenol biosynthetic process
GO:0006383 = Biological process: transcription from RNA polymerase III promoter
GO:0006744 = Biological process: ubiquinone biosynthetic process

Sequence:
>Contig1368
TTGGGTCAGATTCCCACGACTGGGCATGCGCTCCCTGAGCCAAGCAATAT
ACCAAATAAATCGAACGCCGTCCCGATTATCCCCACGGAATCTGACAACG
GTCACCCGTCCTTCCTCAATACTCCGCCACAAACCTCTCCCAAATGTCAT
ATCTCGAATCAACACCACTACCGCCACTACCACCCCACCAACCTCTCAAA
TCCCACCTGAAATTTATGAACCCCCAAAGTCGGGCCTACTCTCCCACTTC
CCCCGGAAAACAATCCCTTATGCAGAGCTTATCCGCCTCGACAAGCCAAC
AGGGACAATCTACCTCTTCCTCCCATGCCTCTGGTCAACACTCCTCGCTG
GAACCCTCACGGATCCAGTAACTCCCCTTCCAACAGTTCTCGGTACGACC
TTCCTCTTCGCCACTGGCGCGCTGATCATGCGTGGAGCCGGCTGCACAAT
TAACGACCTCTTGGACCGCAACATAGACCTGCACGTCTCGAGGACCAAGT
TCCGACCGATCGCCCGCGGCGCAATAACGCCGTTCAATGCTCTGGCATTC
ACATGCGTACAGCTACTCGCGGGATTGGCCGTGCTCGTGCAGTTCCCGGC
CCAGACGATAATCTGGGGGATTCCGTCGCTGGCGGTGGTGACCGTGTACC
CGCTCATGAAGCGGGCCACGCATTACCCGCAGTTTGTGCTTGGGTTGGCA
TTTTCCTGGGGTGCGTTGCTGGGTTTCCCGGCCCTGGGGCTAGGACTGGA
TGGGCCGGTTATGGCCACCGCTGCGTGTTTGTATGGGAGTAATGTTGCCT
GGACGGTGGTGTATGATATTGTCTATGCACATCAAGATGTTAGGGATGAT
GTTAAGGCGGGGGTAAAGTCGATTGTTGTCAAGCATGAGGCGTATACGAA
GTATCTTATGTCTGCGCTTGGGGCTGCGCAGGTTGGTTTACTGGCAAGTG
CGGGGGCAGTGGCTGGTTGTGGGCCAGTGTTTTACTTGGTTTCTTGTGGT
GGGGCGGCGGGGAGTTTGGCTTATATGATTCGGAAGG

Sequences in the Contig:

SY0AAA48YN08FM1 SY0AAB47YB02FM1 SY0AAD18YC05FM1