Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1367
Length(NT) : 751
Best Gene Model Blast : Link to GSTUMT00006352001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212881.1| Score: 1027 E_value: 1e-110
KEGG Definition: hypothetical protein
Accession: ani:AN5196.2 Score: 1002 E_value: 1e-107
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0282 Score: 823 E_value: 6e-89
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 115 E_value: 8e-07
Swissprot: Q9DC48|PRP17_MOUSE

Sequence:
>Contig1367
TTGGGAACACTGGAGGCATTGGGAAGGAGACCACGGAGTTCCATGGATCG
CAGTTGCGGGATTATCAGGGAAGGACGTACATGCACGTTCCTCAGGACCT
AGATATCGATTTGAAAAAGGAGCCTGGAAGCTGGACAAATTATATCCCGA
AAAAGTTGGTGCATACTTGGAAGGGACACACAAAGCCTATCACTGCATTG
CGATTTTTCCCGGGAAGCGGCCATCTGTTGTTGTCTAGCAGTAGTGATGC
CAAAGCCAAAATTTGGGATGTCTACCATGATCGTGAGCTTCTCCGCACAT
ACAACGGCCACTCAAAGGCTGTCACAGATATCACCTTCAACAACTCTGGT
AGTCAATTCTTAACAGCTTCGTACGACCGCTACATGAAACTCTGGGATAC
GGAAACTGGAAAATGTCTTCATCGTTTCACAACTGGCAAGATACCGCATG
TCATCCGGTTTAATCCTGACCCCGCTCTCCACCACGAATTCGTTGCAGGC
ATGAGTGACAAAAAAATCATCCAATTCGACACCCGCACAGAGCAAGTAGT
CCAGGAATACGACCACCATCTCGGCCCCGTAAACACTATCACCTTCGTGG
ATGAAAACCGCCGTTTCATCACAACCTCGGATGACAAGTCGCTGCGGGCC
TGGGAATACGGCATCCCAGTCCCTATCAAATTCATCGCGGAGCCTTACAT
GTACTCCATGGTCCGTGCCTCGCTTCATCCCTCGGGCAAGTATGTCGCGT
A

Sequences in the Contig:

SY0AAA15YK16FM1 SY0AAA41YH17FM1 SY0AAA48YN02FM1
SY0AAD46YO01FM1