Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1366
Length(NT) : 1383
Best Gene Model Blast : Link to GSTUMT00006583001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64562.1| Score: 354 E_value: 2e-31
KEGG Definition: ankyrin
Accession: aor:AO090138000202 Score: 354 E_value: 8e-32
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 173 E_value: 3e-13
PFAM Definition: No Hit Found
Swissprot: Q71S21|INVSB_XENLA

Sequence:
>Contig1366
TTGGAGATGAGTTATGCCATGCGCTGGGGGTAGAATTGGGGGCGGAAGCC
CTCGACATCAGCAATGTACCTTCAATACAAACTGTGTTATCCTACACCTT
AGGACTTATTACTATTGACGAAAAGGAATCCACAGTCCGCCTCCTTCACT
ACACACTTCATGAGTATTTGCGAGAACATCTCACCCTATTTGTAGCTACG
CACTCAATGATGGCCGAAGTCTGCCTCACGTATTTGAACAGTGCGTTAGT
CCGGGCGCTGCCGCCAAACCCGGACAATGTCTGCCTGACACCACCATTTC
TTGAATATGCAGCATGTTTCTGGGGAACCCATGCAGCCATGGAGGTGACT
GAGACCTTGAAATTTCTGGCGTTACGACTACTGGATGGATACGAAGGTCA
TGTGTCTGCCTCAGTCCTCTGGCAAAAGAAGATACATAAGCCGGGTCTCG
CGGGGCATGTTCGTGGAATAAGCGGACTACACTGCATCGCATTTTGGGGG
ATTGCAGAAATTGCGATTGCTATGCTGGAGACGAAGAGATGGGATGTGGA
TGCACGCGATTCTAGGGGTGACACTGCGTTAATGTGGGCTCTGAGATACA
AAAATGACAAAGTGGCAGAGTTACTTCTAGCCCGGTCAGAGATCAAACCC
GGCGTAGTTGTTACGGGCGGTAACGCGGTACACTCGTTTACTTCTCAGTG
GGGGAATGAAGGTGTAGTGAAGCTACTTGTGGAACACACCGACATCAACC
CCAATTTATCGGATAATTGTGGCCGAACACCGCCAGCATTTGCTGCCACG
TCCGGGCAGGGGGGTGTAGTGAAGCTACTTCTAGAGGGTAGGGGTGTCAA
TCCTGATGCACCGGATAGTAAAGGCCTCACGCCCCTGTCCTATGCCACAA
TTGGGGGGCGAGAGGATATAGTGAGGCTATTTCGAGAACGTGGGGATGCC
AACCCTGATCCGTCTGACAGCAATGAACGATCGCCCATATCACCTGATAC
CGAGCATCGGCACCAGTGCGCCTTGAAGCTACCATCGAAATATGGAAACC
CCGGTAGCGAAGCACCAGGAACCCGTGATCGAACGCCAGTCTCTATCCCT
GATGAGGGTACTCCAGGACAAGTAGCAGTTCCGCTTCCGACACCGGGGGT
GCCTACCCCCTACTCGACAGATGACCTTCTACTCGACGCTTCGAACTCTC
GTCCCGCCACTCCTAGACCTCCCCAGGAACAGTCATTATCGCGCAAACAG
TCTCTACTAAATCAACCAGACTCAGACTCGGCTTCATCTATCCTTTACTC
CATCCTTCGCTCTAGCTTAGCGATTTTCTTTTCCCTACTACCTTTACTTT
TGTTGCTCGTTTTCCATGGCTACGGTGATTCTC

Sequences in the Contig:

SY0AAA48YM11FM1 SY0AAB12YB08FM1 SY0AAB47YM22FM1