Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1365
Length(NT) : 1377
Best Gene Model Blast : Link to GSTUMT00006670001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_06549
Accession: ref|XP_001796917.1| Score: 1032 E_value: 1e-110
KEGG Definition: kinesin (SMY1 subfamily)
Accession: aor:AO090103000408 Score: 981 E_value: 1e-104
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0161 Score: 204 E_value: 1e-16
PFAM Definition: Filament, Intermediate filament protein..
Pfam Number: pfam00038 Score: 152 E_value: 1e-10
Swissprot: Q86Z98|KINH_GIBMO

Sequence:
>Contig1365
TTGGGTCAAAATGTCAACCAAGGAGACCTCGGCCCTGCTGGACGAAAAGG
AGAAGAAGAAGGCGGAAAAGATGGCTAAGATGATGGCTGGTTTCGATCTG
GGTGGCGAGGTCTTCTCAGATAGTGAGCGGATGATCAGGGAAGTCATACA
TCAATTAGATGCGATTCAGGACAACTCTGCCTCCGGCGAAGAAATCACAT
CTGATGTTATCAGAGACCTCCGGGCTAGACTTGTAGAAACCCAAGGCATT
GTGCGCCAGGTAGAGCTCTCACTCAACGAACGCTCTGAAGAACAAGATTT
AGCCCAAAAACGGCGAGAAGAGCTTGAAACAAGACTGCTGGATCTTGAAC
AAGAATTTGAGGAGTTACTAGAGAGGAATCTCTCTGGTGAGGATATCGCA
GAGGTCAAGGGCCGGCTTGAGCAGGCGTATTCCAGTAAACAGGACGTTGA
GGTACAGATACTAGAGGATTTGAAGAAGGAGCTTTCCAAGAAGAGCGACG
AGAACGAGAAATTGAAAGCTTCCATGGATGAGCTACAACGAAGGATTAAA
GCTGGTACTGCCATGAATGGCGCCGCCGGTGCTCTGCCTGGTGGCAAAAC
TGTCGCCCAACAGATTGCTGAATTTGATGCAATGAAGAAATCTCTCATGC
GTGACTTGCAGAACCGTTGTGAGCGTGTTGTCGAGCTGGAAATTAGTCTA
GACGAAACGCGGGAACAATACAACAACGTTCTCCGTTCGTCAAATAACCG
AGCACAGCAGAAGAAGATGGCCTTCCTGGAACGAAACCTCGAGCAGCTCA
CCCACGTTCAACGGCAGTTAGTTGAACAGAATAGCACGCTAAAGAAGGAG
GTTGCTATCGCTGAACGCAAGCTTAATGCTAGAAATGAGCGGATACAGAG
CTTGGAAAGCCTACTTCAAGATTCCCAAGAAAAACTAACCGCTGCCAACC
ATAGATTCGAGGCACAGCTTACTGCTGTAAAGGAGCGGTTAGAAGCTGCC
AAGGTCGGTACCCGGGGAATTGGAGGAACCAACTTTAACTTTCAAGGATC
TCGTATTGCGAAGCCCCTTCGCGGTGGTGGAGGCTCATCTGGCGACGCCA
ATGTAGCACCAGTGCCACTCTCTAGTGTTCAGGGATCTGCAGCCCAGCAG
GAAGTCCAGCACCCAAAGCGTGGTTCATGGTTCTTTGAGCGAAAATAGAG
ATGGATACAGTACAATATTTGGGGTGCTGTGAGTAGACATTGTCAAACGG
AACTAGCGCTGTACGCACGATTGATGCCCGTCCGGCGGATCACTAGTCGT
GACAAAAGCTCTTATTATCCCCGAATAATGAACTCGAAAAAACCCTTTCT
TTATGTCCATTATGTTCTCATGCTATG

Sequences in the Contig:

SY0AAA48YL20FM1 SY0AAC55YM07FM3 SY0AAD20YN19FM1