Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1363
Length(NT) : 1282
Best Gene Model Blast : Link to GSTUMT00010778001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_05210
Accession: ref|XP_001593782.1| Score: 1421 E_value: 1e-155
KEGG Definition: hypothetical protein
Accession: ang:An14g05960 Score: 1406 E_value: 1e-154
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2964 Score: 1100 E_value: 1e-120
PFAM Definition: Arginase, Arginase family..
Pfam Number: pfam00491 Score: 405 E_value: 4e-40
Swissprot: Q10088|SPEB1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1363
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTATGCCCTTAGCTTTGAA
ACGTGTAGTTGGGTCCGGGGACTACAAATATCTAGGTAGATAACGTGAAT
TGGGTCGATTAAATACGGGAAGAGAGAGAGGTCAATTGAAGAAAAGAGGA
AAAAAAAGATACATCAAGTATGTTTACCAGGACTTTACTTTTCACCGCGT
TGGTGGGGTTGGGCGGCGGAGGCGTAGCTTGGGGACATGAGCATTCCGGA
AGTTTGCAAGAACACTTGGGTGCCCAAGGGCCGCATAGAGAGAGACTGTG
GTATAATGTCTTGCCGGGGGACGGGGGGACGCAGGCAGACAGCGTCTTTA
GTGGGATCTCAACGTTCGGGAGGTTACCGTACTTTCCGTGTCTATCTTCC
GATAAGGAGAAATTTGATATCGCCTTCTTGGGCGCCCCTTTTGACACCGG
AACCTCCTACCGCCCCGGCGCACGTTTCGGCCCATCCGGAATCCGTCAAG
GTTCCCGCCGCCTGAATCTCTACGGCGGCTATAACACTCTTCTTTCCGTG
AACCCCTTCAACTCCTGGGCGCGAGTGCTGGACTGCGGTGATATCCCCGT
AACGTCCTACGATAACGCGTACGCCATCAAGCAAATTGAGCAGGGACACT
ACAGTCTCTTGTCCAGGACGCCAGCCTACGAAGCGGACGAGGGGCGAAAG
GGCCCGGCGAAGGGTGGGAAGGTGTTGCCTAGGATTATCACGCTTGGGGG
TGATCACACGATCGTGCTGCCGATTCTTAGGAGTGTGAAGAGGGCTTATG
GACCGGTTTCTGTTATCCATTTTGACAGCCATCTGGATACTTGGGTGCCA
AAAGTATTCGGCGGTGCACCGACTGAGCAGGCTTCTGTTAACCACGGGAC
TTACTTTTGGCACGCATACAAAGAAGGTCTCCTAAAAAATAATACCAACA
TCCACGCCGGAATAAGAACTACACTGTCCGGCCCTAGCGATTACGAAAAT
GACGCCGTCGTCGGCTTCAACCTCATAGAGGCGCACGAAATCGACGAAAT
TGGCGTCGGTGGAATAGTTAAGAAGATCCGGGAGAGGGTTGGTGAAGGAC
TAGTCTACCTCTCAATTGATATTGACTCGTTGGATCCGGCATTCGCGCCT
GCGACCGGAACGCCCGAGACTGGGGGGTGGAGTACGCGCGAGTTGAGGGC
TATCATTCGCGGCTTGGATGGGCTGCAGTTGGTTGGCGCGGATATTGTGG
AGGTTGCGCCAGCTTATGATACTAATGCTGAG

Sequences in the Contig:

SY0AAA17YF19FM1 SY0AAA48YK04FM1 SY0AAC18YC17FM1
SY0AAC29YL15FM1 SY0AAC36YO05FM1 SY0AAC51YA07FM1
SY0AAD61YK17FM1