Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1362
Length(NT) : 672
Best Gene Model Blast : Link to GSTUMT00005269001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SNOG_16447
Accession: ref|XP_001806563.1| Score: 422 E_value: 7e-40
KEGG Definition: hypothetical protein
Accession: ang:An03g04550 Score: 394 E_value: 6e-37
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2634 Score: 434 E_value: 7e-44
PFAM Definition: Init_tRNA_PT, Initiator tRNA phosphoribosyl transferase. This enzyme (EC:2.4.2.-) modifies exclusively the initiator tRNA in position 64 using 5'-phosphoribosyl-1'-pyrophosphate as the modification donor. As the initiator tRNA participates both in the initiation and elongation of translation, the 2'-O-ribosyl phosphate modification discriminates the initiator tRNAs from the elongator tRNAs..
Pfam Number: pfam04179 Score: 461 E_value: 6e-47
Swissprot: Q10181|YAW6_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1362
TTGGGCCCCTAATCTCGCAACAATGCCTCCGAGCAACCCATCACATCTCA
AAATGACCCCCTTAATCGCAACAACAAAAACAGAACTGACCTCTATCGAG
CCCGAAGAACTTGACACCTCCAGCCCAGAACCCGAAGACCTAACCCAATA
CACCTTCACACTAACCCCAGACCTCCTATCAACAATCCGCCCAACTCACT
CCTCCCTAAAAAACTCACTCCGCACGCAGACCCGCAGCCTAAGAAACCGC
CTCACATCAATCACCGCAGACTCACAATTTGTCCTCAGCGTTGCGGCCGC
ATACGCCCTCCCGCTTATACCCAACGCCCGGGCGGGTGACTGGTACGTCC
CGCCAGAGCACAGGGGAAGCAATACGAGTGCGTATTTCAAGAGCACCGAC
GGACACCCGGGGCAATGGGGTTTCAGTCTGCGGAGGCTGAACTTGCATAT
TTTGGAGCGCGTGGGGAGGTGCGGTGGCGTTGTCCTCGTGGACTCGACGA
GACGGGGGAAGAGGTTCCCTGATGCGCTGAGTAGGACGGTGCCAATTTGG
ATCGCGGTCGTGAATTGGTGTTTGTTTGGTCGGGAGTTTGGTGGATTGTA
TGTCTCCGAAAAGATGGTTTCAGGGAGTGAGAGAGTACAGATCGAGCGGT
TGGTGCCGGGGTTTGTGGAGAG

Sequences in the Contig:

SY0AAA48YJ23FM1 SY0AAD13YF05FM1 SY0AAD32YK04FM1
SY0AAD56YI07FM1