Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1361
Length(NT) : 1061
Best Gene Model Blast : Link to GSTUMT00006385001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001260601.1| Score: 547 E_value: 5e-54
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_2G11320 Score: 527 E_value: 5e-52
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P87236|MU154_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1361
TTGGCTACTTTGTTTGATATCGCGCGCAAACTCCAATGGTGGCCACAGGC
GCAGCGGTGCCGAGGATGTCCTGCGGCGGCCTGCTGGTGGGTACTCGGGC
GGTATTAGCAGCGGTGGCGGTGCTGGATTATCTTATTTTTTTTGGATCCT
ATCGTGGGTCCTAGCCGCTGGGAGTGTTTTCAATGCTATTTACTGTTTCT
CACGGAAGAAGCGGTATAGACTGTTTGAAAGTAATATTGAGGTCGAGCCT
ACGACGCCTAGTGCCCGTAGGGTGCCTGTGGATTCCTCACCTACCACTAC
CTCCCCTCTGCGCTTGTTTGGTAATATCATGGAGTCCTTCACGGGCACTC
CAGAATCAAGGTCGCATCCGGATGAAACTCGTGACGTATGGGAGGTTTCT
GTGTGGGACCCAACGCCACTCTCCCTCAGGCTGTTTGCCATCTTCTCCCC
GGTGCACGTCCTCATCTATTTCCTCGTGCTGCCGATAACCTCAAACGCCA
CCTTGTCCAGCTCAGGCTTTGTCAAATTCCCCACACCGCCGACGACGAAT
ACCGTTGGGACCATACTTATGATGCTTGCCACGCAGTTTATACTTTCGGT
GCAATTGATACATACCCAAATGTCGTTTGCTCAACAGGCCAAGGATACCA
CTCTGATTCACAAGGAGGTTTTGCACGAGTACGATCAAAAGTTTGTTCAC
CCGCGCCTCAACGTTCTCAAGCGAGACGTAGCAGTGCAGACGGCAAACAG
GGAGTCTGGCGAGGCTGCCAGCGTGAGCTTTTTCACACCGAATCTGAATA
GGCAAGGGTTCAGGACCGCCCCAAATCCTAATTATGCAGATCTTACAATG
CGGGACAAGGTTGGCTCCATGAGACACACCCCATCTACATCCGCTAGATC
ACCATTTTCCCCAATGCCATTGAAGGGCTCCATGAGACAGCCCCAGTTTG
GCCCCGTGAGGAGGCCCGCGTCTACATCTATGATCGACAGTGGAAGCTTT
GGTACAGATGTTGATGAAGATTACGGCGGCAGCAGTGACAGTGCCGCAAT
GGCATCCACAA

Sequences in the Contig:

SY0AAA48YJ21FM1 SY0AAC53YE10FM1 SY0AAD22YF22FM1