Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1360
Length(NT) : 804
Best Gene Model Blast : Link to GSTUMT00002926001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001586321.1| Score: 539 E_value: 3e-53
KEGG Definition: 20S proteasome, regulatory subunit beta type PSMB1/PRE7 [EC:3.4.25.1]; K02732 20S proteasome subunit beta 6
Accession: aor:AO090003000015 Score: 532 E_value: 8e-53
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0179 Score: 596 E_value: 2e-62
PFAM Definition: Proteasome, Proteasome A-type and B-type..
Pfam Number: pfam00227 Score: 266 E_value: 3e-24
Swissprot: P23724|PSB1_YEAST
Gene Ontology:
GO:0019774 = Cellular component: proteasome core complex, beta-subunit complex
GO:0004175 = Molecular function: endopeptidase activity
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig1360
TTGGAACAGAGCTCCTCACCCCATCAGCTTCATCCATCTCCGAGCTACCG
AATCGATAGAGATACCTGCACAAATATGTCTTTACCTTTTATGCAGCCGC
TCGGCTACGACCAGTCCTATTCCTTCCATACACCGACATCTAAAGCTTCA
GGAGGATACACCCAGCACAGTTTTAACCCCTACACAGACAATGGCGGAAC
CATCATAGGGATTACCGGTGAAGATTTTGTTGTACTAGCAGGAGATACCA
GGCACACATCCGGCTACAACATCAATTCCCGAACTGAGAAGAAGGTATAC
CGGCTCGGAGAGGATAATAGTCTCGTGCTAGCAACTGTTGGATTCGGGGC
TGATTCCAAAGACGTTGCTGAGACTATGATGAGAGCTGTTAATGACTTCA
AATTCAACCACAACTTGAAAAACATGAGCGTCTCTGCTGCTGCGCAGTAC
CTTTCCACTTTTCTCTATGGCAACCGCTTCTTTCCTAAATATGCGAATTG
TGTTCTTGCTGGCCTGGATAAGGATGGGAGGGCTCGCCTATATTCTTATG
ATTCGGTTGGTTCGTATTCCAAACAAGGGGAGAGCCGGGCATCCGCTGGC
TCTGCATCATCGCTGATTGTCCCTTTCCTTGACAATCAGGTTGAATTCAA
GAACCAGTTTGTCCCTTCGTCGAAGGGCCAGGAGGAGAGACCAGTAGTAC
CTCTTGATCCTGTTACGGTTGCAAAATTAGTGAAGGACGCTTTTACCTCT
GCTACTGAGCGCCATATCGAAGTTGGAGATGGGCTGCAGATTATTACGGT
CACC

Sequences in the Contig:

SY0AAA19YL17FM1 SY0AAA32YJ09FM1 SY0AAA48YJ19FM1
SY0AAD12YK11FM1 SY0AAD49YO12FM1 SY0AAD63YB06FM1