Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig136
Length(NT) : 1036
Best Gene Model Blast : Link to GSTUMT00004429001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: nitrilase
Accession: ref|XP_001547310.1| Score: 610 E_value: 2e-61
KEGG Definition: hydrolase, carbon-nitrogen family, putative
Accession: afm:AFUA_5G02350 Score: 574 E_value: 2e-57
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0807 Score: 254 E_value: 1e-22
PFAM Definition: CN_hydrolase, Carbon-nitrogen hydrolase. This family contains hydrolases that break carbon-nitrogen bonds. The family includes: Nitrilase EC:3.5.5.1, Aliphatic amidase EC:3.5.1.4, Biotidinase EC:3.5.1.12, Beta-ureidopropionase EC:3.5.1.6. Nitrilase-related proteins generally have a conserved E-K-C catalytic triad, and are multimeric alpha-beta-beta-alpha sandwich proteins..
Pfam Number: pfam00795 Score: 321 E_value: 2e-30
Swissprot: Q32LH4|NIT1_BOVIN

Sequence:
>Contig136
TTGGACTCGTAATAGGCCACGAGACAGATGTGCCGGCACCCACCCTACTG
AATAGACTATTGGGAGGAAATAGTCTTTGATCATTGCATGTTGAGAGCCT
CGCTGATCATAGCCTTATGATACGGCGATCTCACCTCGCATCATGACATC
ATCTGAGGTAAGTCGAAAACCGAGCCTCACGGAAATAAACTTACCCTTCC
GTGAGTCCTACATACTGTATAGTTCTCAAACCACATTGGAAGGCAAACTC
CATCGAGAAAATGTCTGAAATACCCTCGAAATGGAAGTGCGCCGTAATCC
AACTCCACTCCAAGCCGATGCAGCTGGAGGACAACTTCAATCGTGCCCAG
GGCTTCATCCGGAAAGCTGCTGAGGCAGGCGCTCGACTGGCAGTCCTGCC
CGAGTATTCTCTCACCTCGTGGGTCCCGGATGACCCTGGATTTGCGGATG
CCCATGTCGATAGAGAGTACCTTTCTAAGTTCTGCGAGCTAGCGAAGGAA
TGCAATATCAATATTGTCCCGGGGACGTTCGTTGAGAGACATGTTGACGA
TGGAAAGGATATGCTGTATAACGTTGCCCACTTCATTTCCAATGAGGGAA
AGATATTGGGCTCGTATACAAAGAAGAATCTTTGGCATACTGAGAGGGCG
CACTTAGAGGCCGCTGGAAACAACCCGCATACAGTTATGGACACTCCGCT
GGGAAAAGTCGGTCTTTTGATATGCTGGGACTTGGCATTCCCAGAAGCGT
TTCGGGCACTCATAATCCAGGGCGCAAAAATCATTATAATTCCCTCATTC
TGGAATCTGCTGGACCTGACAGAACCCGCGTTCCAACGGAACCCTAGGTC
TGAGGCGATATATCTTGAATCGATTGTAATATCACGCGCTTTTGAGAACG
TTTCATGCATCGCTTTCGCAAACGTTGGTGGACAAAAAGAGTCTGGCTTT
GCTGGATTATCACAAATAGCAATGCCTCTCATGGGGGACATTGCAAGGGC
TGAGGGCGCTCACGAACAAATGGTCATTGGAGAGGT

Sequences in the Contig:

SY0AAA15YB05FM1 SY0AAA16YG12FM1 SY0AAC44YL03FM1
SY0AAC49YJ17FM1 SY0AAC53YM17FM1 SY0AAD23YP09FM1
SY0AAD35YM02FM1 SY0AAD47YC17FM1 SY0AAD48YA20FM1
SY0AAD48YO02FM1