Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1359
Length(NT) : 892
Best Gene Model Blast : Link to GSTUMT00000073001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein An07g04240
Accession: ref|XP_001391506.1| Score: 654 E_value: 1e-66
KEGG Definition: hypothetical protein
Accession: ang:An07g04240 Score: 654 E_value: 7e-67
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0395 Score: 543 E_value: 3e-56
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 490 E_value: 4e-50
Swissprot: P52498|RSR1_CANAL
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1359
TTGGCATCATAGTCAAACGTTGGTTTGGGCTGAGACGCTGTTGTGGTAGC
GAACGCTCTGCTCGCTCATGTCTAGCTTAACTTAGTTTTTCTTACCTAAA
CTTAACTCGCCTCAGCATCTCACATTGCCCGCACCTACCCACCTGCCTGC
TTACCAGACCCTCTTCACTTCACCTTCTCGCCCCTTCCTCGTTCACAAAC
TATCGTAACTTCACCATCTTCCCATCACCAGCACTCACTACCTACTTACC
GAACTCACATCACCACTCTCAACCTACCTCCGACTCACTCGCTCACCCAC
CCACTCACTCACTCACCATCGCCCGAAAACAACAGGGCGGGTTGCTATAA
CCAAACCAACCATTATCTATGCAGCACAGAGACGAGAGTATCATATTGTG
ATTCTTGGAGCTGGCGGTGTTGGGAAGAGCTGTTTGACATCGCAATTCGT
ACACAACGAGTGGATCGAGTATTACGATCCCACAATTGAGGATGTTTACA
GGAAGGTCATCGATGTTGATGGACGGTCGTGTATTCTTGAGATTTTGGAT
ACTGCTGGGACTGAACAATTTACCGCCATGAGGGAAATTTACATGAAAGC
TGGTCAGGGCTTCCTCCTAGTATACTCAATCACAAGCCTGAGCACCCTCA
CAGAGCTCTCGGATCTCCGCGACCAGATTCTCCGGATAAAGGAAGCCGAT
TCTGTGCCTTTGGTGATTGTTGGTAACAAGTCCGACCTGGAAGAGGATCG
TGCGGTCCGTCGCGACAGGGCGATTATGCTCTCTCAGAAGTGGGGGAGGG
TTCCCTTTTACGAGACCTCTGCACGAAAGCGGCAGAATGTCGATGAGGTG
TTTCTGGACCTTTGCCGGCAGATGATGAGGGCGGATGTGGGC

Sequences in the Contig:

SY0AAA11YN12FM1 SY0AAA15YP03FM1 SY0AAA20YK07FM1
SY0AAA29YH08FM1 SY0AAA38YO11FM1 SY0AAA48YJ16FM1
SY0AAB42YD12FM1 SY0AAB48YL16FM1 SY0AAC62YB22FM1