Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1358
Length(NT) : 1419
Best Gene Model Blast : Link to GSTUMT00009474001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: tRNA (guanine) methyltransferase Trm5
Accession: ref|XP_001263636.1| Score: 421 E_value: 6e-46
KEGG Definition: tRNA (guanine) methyltransferase Trm5; K07055
Accession: afm:AFUA_3G08030 Score: 416 E_value: 1e-45
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2078 Score: 348 E_value: 2e-33
PFAM Definition: Met_10, Met-10+ like-protein. The methionine-10 mutant allele of N. crassa codes for a protein of unknown function. However, homologous proteins have been found in yeast suggesting this protein may be involved in methionine biosynthesis, transport and/or utilisation..
Pfam Number: pfam02475 Score: 254 E_value: 2e-22
Swissprot: Q8TFG7|TRM5_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1358
TTGGGGGTATCCAACACTTCACAATGTTTATGTCTCGGTTCTTGCCACCG
GTTGATCGTGCGATGCGCACACTGGATCGCGCTTTTTTCAGGAAGGTGGT
CCCAGTTACTGGCTGCGCGGGTACTCGACTCTGCACTGGTTCACACCATC
AAGGAGAAGATTCTAAAAGACTTGATCCCCTTCGAAAGGTTCAATCAGAG
ATACGACTTCAATTCAAAGCTCAATGTCGAAACTCCACTGCTAATTCTAC
AGCCCCAAGTGAAATACGGTGATCTCTCAACGGCTTCGGGTCCCACGCAG
GAATATGTGAAATCGAAAATACTCGAATTGGTGCCCTATGATCTGAAGTT
GGAGTACGGAGATTGGGGTTATGAGGAAATTATGAAGGCCGTGCTTCCCG
AAGATGTCAACCCCCCAAGTATCGATGACTTTCCTCGAATTGGTCCATTA
TTACACCTGGATGTCCCAGAGCCTCTGCGGGAGTACAGGAATCTTATCGC
GGAAGTTATTTGTGACAAAGAGAGAGAGGTGCAGACGGTTTTTGGTGAGC
CTGAGAAGGTAGGAGGGGCGTTAGAACTTGGGTTGGCAAACGAAGTTCTG
GCGGGTCCTGAAAATTACCGGGTGGAACTCAGTCACCAGGGTTCCAGTTT
CACTTTTCACCTCGACCAAGCCGGGTTCCGTGATGTTTATTTCGACACTA
AGCTGGCGACTGAGCGGCAGCGTCTTGTGGATACTTTTGGGTTGGGGGAG
TGTGTGGCCGATGTTTATTCTGGTGTTGGTGCGCTGAGCGTGGCTGCTGC
AAAGCGGGGAGCGATAGTCTTTGCCAATGAGCGGAGGGACAAGGTTTATC
AATTGCTCGTTGAGAACCGAAGAAACAACAAGGTCAAGAAAAACCTCTAC
CTTAAGAGCCAGGCTCCGGCTAGATTCGTCCAACAGCTTGTCCGAAAACT
TTTCGAGAAAACAGTGGACTATAAACCCCAGAAAATTAGCAAGCTTGGAA
AACTTATCAAAAATCCTCTCAAGAAGGGAGATAAGAACCTCCCCGCCTGC
GTTTCTCACATCGTCTTCAGCGACCCTGACCAATCCCTTACACACCTCGA
GTGTCTCAGGGGTATATACACGAAGCGAGAGAGACTCTTTGCGAACAGGG
GGGGGAGTTTTTGGAAATTAGATTTTCCGTTTGTTCATGTCTACGCCTAC
CACAAAGCTCCAGCGGAAAAAAAGGCGGATGCGGTAAACGATCTTCTCAA
GAAAATCGGCAAGAGGATTGGCCACGACCTGAGACGGGGATGTGTCCAAC
AGGCGCACTTTGTTAAGAAAGGCTCAGAGGATAACCTTTATTGCATTACA
TTTAAACTTCCGCCACCTGTGGCATTCGATATTAGAGAGGAAGAACTACA
TCAAAAACAGCCGGAGATG

Sequences in the Contig:

SY0AAA48YI22FM1 SY0AAA6YH20FM1 SY0AAC43YL11FM1
SY0AAC5YF06FM1